ID: 1026672313

View in Genome Browser
Species Human (GRCh38)
Location 7:72401064-72401086
Sequence GTTGACACCTTAGCAAAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 113}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026672313_1026672318 20 Left 1026672313 7:72401064-72401086 CCCGTTTTTGCTAAGGTGTCAAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1026672318 7:72401107-72401129 GGAAAAGATGACCTATAGATGGG 0: 1
1: 0
2: 4
3: 22
4: 388
1026672313_1026672315 -1 Left 1026672313 7:72401064-72401086 CCCGTTTTTGCTAAGGTGTCAAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1026672315 7:72401086-72401108 CATGCTTCTCTCAATGTACCTGG 0: 1
1: 0
2: 0
3: 9
4: 123
1026672313_1026672319 21 Left 1026672313 7:72401064-72401086 CCCGTTTTTGCTAAGGTGTCAAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1026672319 7:72401108-72401130 GAAAAGATGACCTATAGATGGGG No data
1026672313_1026672317 19 Left 1026672313 7:72401064-72401086 CCCGTTTTTGCTAAGGTGTCAAC 0: 1
1: 0
2: 1
3: 10
4: 113
Right 1026672317 7:72401106-72401128 TGGAAAAGATGACCTATAGATGG 0: 1
1: 0
2: 0
3: 21
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026672313 Original CRISPR GTTGACACCTTAGCAAAAAC GGG (reversed) Intronic
900377453 1:2362414-2362436 GTTGACCCTTGAACAAAAACAGG - Intronic
901242331 1:7702861-7702883 GTTGCCAGCTTTGCCAAAACGGG - Intronic
902131545 1:14265741-14265763 GATGACATCATGGCAAAAACAGG + Intergenic
906903113 1:49859131-49859153 GTTGACATATTAGCAATATCAGG + Intronic
909284810 1:73802358-73802380 GATGACACCTTAGTAAACATTGG + Intergenic
910121064 1:83791107-83791129 GTTGACCCATTAGCCCAAACTGG - Intergenic
913055645 1:115156766-115156788 GTTCATACCTGAGCAAAACCTGG - Intergenic
921878923 1:220231540-220231562 GTTGATACCTGAACAAAATCAGG - Intronic
923188378 1:231596267-231596289 GTTGACACCTTAGGAAATGGAGG + Intronic
924053022 1:240096299-240096321 GAGGACACCTTATTAAAAACAGG - Intronic
924164159 1:241264880-241264902 CTTGACATCTTGGAAAAAACAGG + Intronic
1065908822 10:30283623-30283645 GATGAAACATGAGCAAAAACAGG + Intergenic
1066508846 10:36073044-36073066 GCTGACACCTTACCAAAATTTGG + Intergenic
1068594971 10:58892960-58892982 GATGCCACTTTAGCAAATACAGG - Intergenic
1073880888 10:107978498-107978520 GTTGAAACCATAGCCAAAATTGG + Intergenic
1073996120 10:109317176-109317198 GGTGACACATTATCAAAAAGAGG - Intergenic
1075546948 10:123362290-123362312 GCTGACAACTGAGCAAAGACTGG - Intergenic
1075549003 10:123378472-123378494 GTTGAGTCCTCAGCAGAAACTGG + Intergenic
1080884887 11:36358019-36358041 GTTGAAACCTCAGCATTAACAGG + Intronic
1083179765 11:60977571-60977593 GATGACACCTTGGCCAACACTGG - Intronic
1088925205 11:114294988-114295010 GCTGACTCCTTGGAAAAAACCGG + Intronic
1094165485 12:27438680-27438702 GTTGCCAGTTTAGCAAATACAGG + Intergenic
1094688144 12:32741058-32741080 GCTGACAGATTACCAAAAACTGG - Intronic
1097769792 12:63570504-63570526 GTTGTCACTTTGGGAAAAACTGG + Intronic
1099747838 12:86729809-86729831 GTCAACAACTTAGAAAAAACTGG - Intronic
1101023031 12:100573083-100573105 GTTGACTCTTCAGCAAACACCGG - Intergenic
1109188831 13:59301425-59301447 GATGAAACCTCAGGAAAAACTGG - Intergenic
1109705647 13:66088384-66088406 GTTGACTCCTAAGCAAACAATGG + Intergenic
1110112577 13:71766405-71766427 GGCTACACCTTAGAAAAAACTGG - Intronic
1110427261 13:75382411-75382433 CTTGACACCTTTGCATATACTGG + Intronic
1115676985 14:35687485-35687507 TTTGACAGCTTAGCAAAGCCTGG - Intronic
1118360484 14:65052642-65052664 TATGATACCCTAGCAAAAACTGG - Intronic
1122502747 14:102212258-102212280 GTACACTCCTTGGCAAAAACTGG - Intronic
1123788357 15:23694718-23694740 ATTGACACATTAGTAATAACTGG - Intergenic
1126841038 15:52717698-52717720 GTTGACATCTTAGGAACACCAGG + Intergenic
1130999026 15:88923396-88923418 GTTGTAACCTTAGTTAAAACGGG + Intergenic
1135420255 16:22301103-22301125 GGTGACATTTGAGCAAAAACCGG + Intronic
1135657984 16:24268205-24268227 GATAAAACCTTAGCATAAACAGG + Intronic
1139032897 16:62906896-62906918 GTTAACAACTTATCAAGAACTGG + Intergenic
1139252769 16:65511912-65511934 GTTGAAATCTTAGCAAAAATTGG + Intergenic
1141150763 16:81563159-81563181 GTAGACACCTTTTCAAGAACTGG - Intronic
1145819136 17:27817949-27817971 GGTGACACATGAGCAAAGACTGG - Intronic
1149751093 17:59146159-59146181 GATGAAACCTTAGCAAAAATTGG + Intronic
1150824566 17:68463203-68463225 GGGGACACCTCAGGAAAAACTGG + Intergenic
1151209931 17:72537040-72537062 GCTGTCACCATAGCAAAATCAGG + Intergenic
1155357934 18:24971558-24971580 GTTAACACCATGGCAAACACTGG + Intergenic
1166118855 19:40672921-40672943 GTCTACTCCTGAGCAAAAACAGG + Intronic
1168225627 19:54992885-54992907 GTTGACAACTTAGCAAAATAGGG - Intronic
927424378 2:22964835-22964857 GTTGGCACCTTATTAAATACTGG + Intergenic
928963102 2:36949795-36949817 GTGAAGACATTAGCAAAAACTGG + Intronic
929243492 2:39676665-39676687 GCTGACACCTGAACAAAATCTGG + Intronic
930917730 2:56714402-56714424 GCTGTCCCCTTAGGAAAAACTGG - Intergenic
932754876 2:74400459-74400481 GTTGACTACTTAGCAAACACTGG - Intergenic
932947804 2:76257849-76257871 ATTGACAACTAAGCAAAAGCAGG + Intergenic
934155816 2:89199341-89199363 GTCCACACCTTAGCAGAATCAGG - Intergenic
934211506 2:89983418-89983440 GTCCACACCTTAGCAGAATCAGG + Intergenic
938940803 2:136168075-136168097 GATGACAACTTAGCAAGAAAGGG + Intergenic
939619573 2:144401931-144401953 GGCGACACCTCAGGAAAAACTGG - Intronic
941460992 2:165771727-165771749 GTTTAGACCTTAGGAAGAACAGG - Intronic
1169361225 20:4950940-4950962 AGTGACACCTTAGCAGAAACTGG + Intronic
1171417291 20:24991899-24991921 GTTGACACCTAAGAAATATCAGG - Intronic
1173425867 20:42943129-42943151 GTTCACACCTCAGCTAAGACTGG + Intronic
1173591369 20:44227667-44227689 CTTGACACCTTACAATAAACAGG + Intergenic
1173941571 20:46915327-46915349 TTTGACACCGTTTCAAAAACTGG - Intronic
1174002488 20:47385100-47385122 GATGACACTTAAGCAAAACCCGG + Intergenic
1178117215 21:29429711-29429733 TTTAACACCTTAGCATAAATGGG + Intronic
1178534673 21:33402505-33402527 CTGGACACGTTAGCAAAAATGGG - Intergenic
1181448227 22:22996336-22996358 GTTGACACCTCATCAGAAACTGG + Intergenic
1181898226 22:26129899-26129921 GTTGACACTTAAGCCAAGACTGG - Intergenic
950571651 3:13803908-13803930 GTGGACACCTGATCAAAAATGGG + Intergenic
955750025 3:62178003-62178025 GTTGACTCCTCAGTAAATACTGG + Intronic
957478001 3:80751712-80751734 GTTCATAGCTTAGCCAAAACTGG - Intergenic
957751772 3:84428588-84428610 CTTGACACCTTGTCAAAGACTGG - Intergenic
959157247 3:102681956-102681978 TCTGACACCTTTGCAAAATCTGG + Intergenic
960093411 3:113665104-113665126 GGTGATACCTGAGCAAAAACTGG + Intronic
963114354 3:141713658-141713680 GTTGGCAACTGAGGAAAAACAGG + Intergenic
968522508 4:1040325-1040347 GGTGACACCTTTGCAGAAAAGGG - Intergenic
969691814 4:8708053-8708075 GCTGACACCTTTGCAAGAACTGG - Intergenic
969890399 4:10254881-10254903 GTTGGCTCCTCAGGAAAAACTGG + Intergenic
976413264 4:84741699-84741721 TTTGACACCATAGGCAAAACAGG + Intronic
976552788 4:86415443-86415465 TTTGATAACTTAGGAAAAACGGG + Intronic
987581716 5:19802911-19802933 GCTGACACCTTAGGAACAATTGG - Intronic
989568105 5:42921637-42921659 GTTTACATCTTAGCTAGAACTGG + Intergenic
997698750 5:135881462-135881484 GTTGCCACTTTAGCAAAAAGTGG - Intronic
1000818083 5:165948768-165948790 TTTGACACCGTATCAAAAAGGGG - Intergenic
1002983175 6:2162298-2162320 CTTGTCACCATTGCAAAAACTGG - Intronic
1008797906 6:55327373-55327395 GTTCACAACTTAGGAAACACTGG + Intergenic
1010002485 6:70961798-70961820 GTTGACACATACGCAAAAATAGG - Intergenic
1014463047 6:121721296-121721318 GTTGTCATCTGAGCAAAATCTGG - Intergenic
1015837090 6:137432196-137432218 GTTGACAGCTTGGCAAAATGTGG - Intergenic
1015858218 6:137648452-137648474 GTTGCCACCTAAGGACAAACAGG + Intergenic
1016666666 6:146650238-146650260 GTTTACATTTTAGCCAAAACTGG + Intronic
1016931883 6:149419467-149419489 ATTGCTACCTTAGCACAAACTGG - Intergenic
1021105098 7:16629182-16629204 GCTGTCACCTTAGCAGAAATTGG + Intronic
1024603468 7:51006993-51007015 GTTGACAGCATAGCCAAGACTGG + Intergenic
1026672030 7:72399113-72399135 GCTGACACCTTAGCAAAGACAGG + Intronic
1026672313 7:72401064-72401086 GTTGACACCTTAGCAAAAACGGG - Intronic
1027782747 7:82540019-82540041 TTTGACACATTAGAAAAAAATGG + Intergenic
1028204688 7:88002938-88002960 GTTAGAACCTTAGTAAAAACTGG + Intronic
1032433333 7:131880519-131880541 TTGCACACCTTAGCAAAATCAGG - Intergenic
1034149724 7:148905449-148905471 GTTGAAACCTTAGCCCAGACCGG - Intergenic
1034313035 7:150106774-150106796 GTTGGCACCTTAGCCAAGATTGG + Intergenic
1034793829 7:153993890-153993912 GTTGGCACCTTAGCCAAGATTGG - Intronic
1035146034 7:156818424-156818446 GTGGACAGCTTAGCCAAAATTGG + Intronic
1044032827 8:87259772-87259794 CTGGACTCCTTAGGAAAAACAGG - Intronic
1044807051 8:96019063-96019085 ATACACACCTTAGCAAAAAAAGG - Intergenic
1045170152 8:99656850-99656872 GTAGAGAGTTTAGCAAAAACTGG + Intronic
1045240421 8:100395909-100395931 GTTGTAAACTTAGCAAAAGCAGG - Intronic
1046237878 8:111450534-111450556 GTTGACAGCCTAGAAAAAAATGG - Intergenic
1046289250 8:112135632-112135654 CTTGACAGATTACCAAAAACTGG - Intergenic
1051628411 9:19120475-19120497 TTTGAAACCTTAGCAAAAATTGG - Intronic
1055703294 9:78970342-78970364 ATTCACACCTTAGCAAATTCAGG - Intergenic
1057108980 9:92448780-92448802 GTCTACACCTTAGCAGAATCGGG + Intronic
1061305153 9:129728193-129728215 GTTCACACCTTAGAAAAAGTGGG + Intergenic
1061318518 9:129813283-129813305 GTTTTCACCTTAGCAACAATGGG - Exonic
1187203474 X:17158706-17158728 GTTGCCAACATAGAAAAAACAGG - Intergenic
1188970432 X:36608517-36608539 TTTGGCACCATAGTAAAAACAGG + Intergenic
1191233547 X:58116329-58116351 ATAGACACCTTGGCAACAACAGG + Intergenic
1191668963 X:63731406-63731428 GTTCACACCTTCCCAAAAATAGG - Intronic
1192287613 X:69755335-69755357 GGTGATACCCTGGCAAAAACAGG - Intronic
1195101411 X:101558057-101558079 AATGACACCTTAGAAAAAAAAGG - Intergenic
1198073219 X:133169987-133170009 GTCTACACCTTAGCAGAATCAGG - Intergenic
1198458449 X:136840005-136840027 CTTGACAACTTAGAAGAAACTGG - Intergenic
1198498308 X:137215995-137216017 CTGGACACCTTGGGAAAAACAGG + Intergenic
1200893190 Y:8345275-8345297 GTTTTCACCTTCCCAAAAACTGG + Intergenic