ID: 1026674598

View in Genome Browser
Species Human (GRCh38)
Location 7:72418266-72418288
Sequence CTGCATCTATGTTGTTGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4178
Summary {0: 1, 1: 13, 2: 202, 3: 1217, 4: 2745}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026674594_1026674598 11 Left 1026674594 7:72418232-72418254 CCTGCATTAATCTGCTTAGGATA 0: 4
1: 192
2: 631
3: 2483
4: 3462
Right 1026674598 7:72418266-72418288 CTGCATCTATGTTGTTGTAAAGG 0: 1
1: 13
2: 202
3: 1217
4: 2745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026674598 Original CRISPR CTGCATCTATGTTGTTGTAA AGG Intronic
Too many off-targets to display for this crispr