ID: 1026676313

View in Genome Browser
Species Human (GRCh38)
Location 7:72431424-72431446
Sequence TGTGCATGCGTGTGTGCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026676313_1026676314 14 Left 1026676313 7:72431424-72431446 CCACATGCACACACGCATGCACA No data
Right 1026676314 7:72431461-72431483 CAGCCTCTATTGCCACTCCGTGG 0: 1
1: 0
2: 1
3: 4
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026676313 Original CRISPR TGTGCATGCGTGTGTGCATG TGG (reversed) Intronic