ID: 1026676478

View in Genome Browser
Species Human (GRCh38)
Location 7:72432694-72432716
Sequence CTTGCATCCTTTCTGGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 2, 1: 1, 2: 10, 3: 43, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026676475_1026676478 9 Left 1026676475 7:72432662-72432684 CCTGTAATTGGATACTCATCTTT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG 0: 2
1: 1
2: 10
3: 43
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026676478 Original CRISPR CTTGCATCCTTTCTGGAACA AGG Intronic
900602148 1:3507453-3507475 CTTGAATGCTTCCAGGAACAGGG + Intronic
901865655 1:12105105-12105127 CATGCCTCCCTTCTGGAAGATGG - Intronic
902399560 1:16150598-16150620 CTGTCAGCCCTTCTGGAACATGG + Intronic
902729646 1:18361074-18361096 CTTCCATCCTTTCTGGAAGTTGG - Intronic
903228753 1:21909228-21909250 TCTGCAGCCTTTTTGGAACAGGG - Intronic
903610265 1:24606304-24606326 CTTGCAACCTTTCTTCAAGAGGG - Exonic
904789432 1:33007557-33007579 CCTCCAGCCTTTCTGGAATACGG + Intergenic
905516510 1:38565767-38565789 CATGCATCCTTTATGTAACGTGG - Intergenic
905517654 1:38573774-38573796 CTTAAATCTTTTATGGAACAAGG + Intergenic
907893132 1:58655512-58655534 CTTACATTTTTCCTGGAACAAGG - Exonic
908703110 1:66923690-66923712 CTTGCATTCTCTCTTGAATATGG - Intronic
909388883 1:75094613-75094635 CTTGTAGTCTTTCTGCAACAAGG + Intergenic
910206491 1:84753580-84753602 CTCGCATGGTTTCTGGCACATGG + Intergenic
910208499 1:84771693-84771715 CTTAATTCCTTTATGGAACATGG + Intergenic
910705905 1:90129371-90129393 GTTACATCATTTCAGGAACATGG + Intergenic
910730757 1:90393256-90393278 CTTAGATTCTTTCTGGAATAAGG - Intergenic
910801991 1:91156317-91156339 CTCACATCCTTTCTGGAACAAGG - Intergenic
910927764 1:92413724-92413746 CCTCCATCCTTCTTGGAACATGG + Intergenic
911151289 1:94599139-94599161 CTTGCCTGCTGGCTGGAACATGG - Intergenic
911762753 1:101635358-101635380 CTAGCATCATTTCTGGCAGAGGG - Intergenic
912157107 1:106934437-106934459 CTTCCAACCTTTCTTTAACATGG + Intergenic
912747621 1:112258498-112258520 CTTGCTTCCTCTCTGCACCATGG + Intergenic
915086602 1:153393529-153393551 CTTAAATCATTTCTGGAAGAAGG + Intergenic
916695233 1:167228790-167228812 CTTACATCCTTTCTGGAGCAAGG + Intronic
917323165 1:173804935-173804957 CTTTCATAATTTCTTGAACAAGG - Intronic
917448139 1:175123997-175124019 ATTGCCTCCATTCTGGAAGATGG - Intronic
918176873 1:182054532-182054554 ATTGTATCCTTTCTTGAAGATGG - Intergenic
918386072 1:184009350-184009372 CTTCAATCCTTTTTGGAAAAGGG + Intronic
918862900 1:189856249-189856271 CTTGCATACTTTTTGTATCAGGG + Intergenic
920274609 1:204794828-204794850 CTTAAATCCATTTTGGAACAAGG + Intergenic
920911495 1:210221897-210221919 CTTAAATCATTTCTGAAACAAGG + Intergenic
921034811 1:211366862-211366884 CTTAAAACCTTTCTGAAACAAGG - Intronic
921687712 1:218109136-218109158 GTTGCATCCTTTCTGGGAAAAGG - Intergenic
921748902 1:218769744-218769766 CTTGCCTGTTTTCTGGAACCAGG - Intergenic
922022229 1:221716737-221716759 CTTGCAAGTTTTCAGGAACATGG - Intronic
922080393 1:222290200-222290222 TTTGCATGCTTTCTGCAACAGGG + Intergenic
922091912 1:222403664-222403686 CCAGCTTCCTTTCTGGAAGATGG - Intergenic
923036641 1:230289093-230289115 CTGGCATCATTTCTGGAGCATGG - Intergenic
923173439 1:231439090-231439112 CTTGCAAATTTTCTGGAACTTGG + Intergenic
924145660 1:241072334-241072356 CTGTTTTCCTTTCTGGAACATGG + Intronic
924733626 1:246734689-246734711 CTTCCAGCCTTTGAGGAACAAGG - Intronic
1062829400 10:595573-595595 CTTGAAGCCTTTTTAGAACAAGG + Intronic
1063982096 10:11462601-11462623 CTCGCACCCTTTCAGGACCATGG - Exonic
1065127582 10:22588594-22588616 CTTAAATCCTTTCTGGAATAAGG + Intronic
1068479843 10:57576872-57576894 ATTGCATCCTTGGAGGAACAGGG + Intergenic
1069338599 10:67384106-67384128 TTTATATCCTTTCTGGCACAAGG - Intronic
1069600410 10:69702175-69702197 CTTCCTTACTTTCTGGCACAAGG + Intergenic
1069961328 10:72081019-72081041 CTGGCTTCCCTCCTGGAACATGG + Intronic
1072530909 10:96318073-96318095 CTTCCATCTTTTCTGGACCTTGG + Intronic
1073028435 10:100505873-100505895 CTAACATCCTTTCAGGAAGATGG + Intronic
1074663865 10:115695825-115695847 GTTGTATCCTTTCAGGAACATGG - Intronic
1074766145 10:116701507-116701529 CTTGAATCCTGTCTGAAACAAGG + Intronic
1075418956 10:122286766-122286788 CCTACATTCTTTCTGGAATAAGG - Intronic
1075699033 10:124456644-124456666 CTTCCTTCCTTTCTGAGACAGGG - Intergenic
1077504725 11:2924672-2924694 CTTGGAAACTTTCTGGAGCAGGG + Intronic
1078517579 11:12036842-12036864 CTTGCATCCCTACTTGAGCAGGG - Intergenic
1079032544 11:16996501-16996523 CCTGAAACCTTTCTGGAACTGGG - Intronic
1080441557 11:32299328-32299350 TTTAAATCCTTTTTGGAACAAGG - Intergenic
1080732986 11:34979418-34979440 CATGCCTCCTTTCTGTAACGAGG + Intronic
1081353754 11:42088110-42088132 CTTGCCTAATTTCTGGAAAAGGG + Intergenic
1081729560 11:45360552-45360574 CCAGCATCCTTGCTGCAACATGG + Intergenic
1082618101 11:55386999-55387021 CTTGCATCATTTATAGAACGAGG - Intergenic
1083134401 11:60658120-60658142 CTTGCCTGCTTTTTTGAACAAGG + Intergenic
1085852859 11:80141831-80141853 CTTGAATCCTTTCTGGAACAAGG + Intergenic
1086325773 11:85697634-85697656 CTTGACTCCTTTATGGAGCAGGG - Intronic
1087923679 11:103895420-103895442 CTTCCATCCTCTCTGTAATAGGG + Intergenic
1089813868 11:121154891-121154913 TTTGCATCCTTTCATTAACACGG - Intronic
1091960656 12:4691474-4691496 CTTAAATCCTTTCTGGAACAAGG - Exonic
1092336215 12:7636294-7636316 CTTTCTTCCTTTCTGGATCCAGG - Intergenic
1092701840 12:11240575-11240597 CTTGCATATTCTCTGGCACATGG - Intergenic
1094303508 12:28992789-28992811 CATTCACCCTTTCTGGAATATGG + Intergenic
1095265987 12:40158405-40158427 CTTGAATCCTTAATGCAACAAGG - Intergenic
1095629739 12:44361529-44361551 CTTGCACAGTTTCTGGCACATGG + Intronic
1096297786 12:50398450-50398472 CTTGCATCTTTTATGCAGCATGG + Intronic
1096729807 12:53599883-53599905 TCTTCATCCTTTGTGGAACATGG + Intronic
1097962283 12:65544448-65544470 CCTCCATCCTTTCTAGACCAAGG + Intergenic
1098812298 12:75110189-75110211 CCTTAATCCTTTCTGGGACATGG - Intronic
1100219326 12:92487100-92487122 CCTAAATCCTTTCTGGAAGAAGG - Intergenic
1101483734 12:105129892-105129914 GTTACATGCTTTATGGAACATGG - Intronic
1102207728 12:111101768-111101790 CTTGGGGTCTTTCTGGAACAAGG + Intronic
1102237330 12:111302071-111302093 CTTGAACCATTTCTGGAACAAGG + Intronic
1102411243 12:112721124-112721146 CTAGCATAGTTTCTGGCACACGG + Intronic
1102971733 12:117173396-117173418 CTTAAATACTTTCTGGAAGAAGG - Intronic
1103478861 12:121238094-121238116 CTCAGAGCCTTTCTGGAACAAGG - Exonic
1103817988 12:123674225-123674247 CTTGAATCCTTTTTGGGAGAAGG + Intronic
1104412204 12:128568376-128568398 CTAAAATCCTTTGTGGAACAAGG - Intronic
1106439849 13:29756715-29756737 CTTGCATATTTCCTGGCACATGG + Intergenic
1107712133 13:43160575-43160597 CTTGCAACTTTTCTAGATCAGGG + Intergenic
1109599595 13:64607320-64607342 TTTAAATTCTTTCTGGAACAAGG - Intergenic
1109710502 13:66152659-66152681 CTTCCTTCCTTCCTGGACCAAGG - Intergenic
1111335596 13:86818012-86818034 ATTTCATCCTTTATGCAACAAGG + Intergenic
1113192490 13:107765707-107765729 CTTGCATCATTTATGAAACCTGG + Intronic
1114213922 14:20641172-20641194 CTTGCTTCCTTTCTGTAAGCAGG - Exonic
1114775018 14:25472148-25472170 CTTTCTTCCTCTCTGGAACAGGG + Intergenic
1114799162 14:25752831-25752853 TTTTAATCCTTTCTGGAACAAGG - Intergenic
1115069898 14:29308694-29308716 CTTGCTAGCTTTCAGGAACATGG + Intergenic
1115309376 14:31964185-31964207 CTTATATCCATTTTGGAACAAGG + Intergenic
1115336553 14:32248395-32248417 CTGTCATCCTTTCCTGAACAGGG + Intergenic
1115340783 14:32291273-32291295 CCTGCAGCTTTTCTGGCACAAGG - Intergenic
1115811362 14:37112152-37112174 CTTTAATCCTTTCTAGAATAAGG - Intronic
1116308248 14:43286775-43286797 CATGCATCCTTTATAGAATATGG + Intergenic
1116896412 14:50319560-50319582 CCTAAATCCTTTCTGAAACAAGG - Intronic
1118234051 14:63984523-63984545 CTTGCTTCCTTTCTGTAAAATGG + Intronic
1121073536 14:91047175-91047197 CTTACATCTTTTCTGGACCAAGG - Intronic
1121175167 14:91885480-91885502 CTTGGATCCTCCCTGGGACATGG + Intronic
1121600596 14:95200205-95200227 CATGCAGCCTTTCTGGATCTGGG + Intronic
1126499045 15:49324295-49324317 CTCGCATCCATTCTTCAACAAGG + Intronic
1126751253 15:51878822-51878844 CTTCAATCTTTTCTGGAACAAGG + Intronic
1127939158 15:63676227-63676249 CATAAATCCTTTCTGAAACAAGG + Intronic
1128043658 15:64597590-64597612 CCAGAATCCTATCTGGAACAGGG - Intronic
1128785400 15:70393261-70393283 CTAGCATCATGTCTGGCACATGG + Intergenic
1128864502 15:71104095-71104117 ATTCCATCTTTTCTGGAATAAGG + Intronic
1129155893 15:73717696-73717718 CTTGCATTCTTACTGCCACAGGG - Intergenic
1129987476 15:79930904-79930926 CTTGCTTTCTTACTGGAAGAGGG + Intergenic
1130211337 15:81925742-81925764 TTTGCATTCTTTCTATAACAGGG - Intergenic
1131920019 15:97315973-97315995 CTTGCATCCTTGATGTGACAAGG + Intergenic
1132363914 15:101242147-101242169 CTTAAATCCCTTCTGTAACAGGG - Intronic
1133440285 16:5815592-5815614 GTGGCTTCCTTCCTGGAACAGGG - Intergenic
1133975012 16:10594556-10594578 CTGGCATCCTTCCAGGAACGAGG - Intergenic
1134204988 16:12229897-12229919 CTTTCATTCTTTCTAGGACAGGG + Intronic
1134377092 16:13687138-13687160 CTTGGATCCTGACTTGAACAAGG - Intergenic
1134484702 16:14648470-14648492 CTTGCAGCCTTTCAGAAATATGG + Exonic
1135138200 16:19900197-19900219 CTTCCATTCTTTTTGGAATAGGG - Intergenic
1136735965 16:32468082-32468104 CTTGCCTCATTTCTGGCACTGGG + Intergenic
1137289164 16:47039957-47039979 CTTGCTTCCTGTCTGTAAAATGG - Intergenic
1137312482 16:47278498-47278520 CTTGCATACTGCCTGGACCATGG - Intronic
1138043110 16:53696041-53696063 CTTGAATCTTGTTTGGAACAAGG - Intronic
1138411755 16:56845902-56845924 GCCGCATCCTTCCTGGAACATGG - Intronic
1139281285 16:65773030-65773052 CTTAAATACTTTCTGAAACAAGG - Intergenic
1140131934 16:72170387-72170409 CTTAAATCCTTTCTGGAACAAGG + Intronic
1140580210 16:76222694-76222716 CCTGCATTATTTTTGGAACAAGG + Intergenic
1140951520 16:79822973-79822995 CTTCCATCCTCTTTGCAACAGGG - Intergenic
1203017110 16_KI270728v1_random:361492-361514 CTTGCCTCATTTCTGGCACTGGG - Intergenic
1203035445 16_KI270728v1_random:634650-634672 CTTGCCTCATTTCTGGCACTGGG - Intergenic
1143924847 17:10360490-10360512 CTTGCTTTCTTTATGGAAAAGGG - Intronic
1146651129 17:34607062-34607084 CTGGGATCCTTCCTGGGACAGGG + Intronic
1147658463 17:42104477-42104499 ATTACAGCCTTTCTGGAACCAGG - Intronic
1147911607 17:43859392-43859414 CCTCCATGCTTGCTGGAACAGGG + Intronic
1149791523 17:59481902-59481924 CTGAAATCCTTTCTGGAACAAGG - Intergenic
1150628347 17:66858294-66858316 CTTGCCTCCTTTCTGGACCCGGG + Intronic
1150923174 17:69504859-69504881 TCTTAATCCTTTCTGGAACAGGG + Intronic
1151129684 17:71883411-71883433 TTTCAATCCTTTCTGGAATAAGG - Intergenic
1151263058 17:72931753-72931775 CTTGAATCCTTTCAGTGACAGGG + Intronic
1151520153 17:74622699-74622721 CTTAAATCCTTCCCGGAACAAGG - Intronic
1152000674 17:77643345-77643367 TTTGCATCCTGTCTGTAACCTGG + Intergenic
1152170570 17:78744321-78744343 CCTGCAGCCTTTCTGGAATTTGG + Intronic
1155947703 18:31875060-31875082 CTTAAATTCTTTCTGGAAAAAGG + Intronic
1156782354 18:40866207-40866229 CTTGCATATTTCCTGGAATAGGG + Intergenic
1157735417 18:50044498-50044520 CTTGCCTCCTTTCTGCAACTAGG + Intronic
1158563366 18:58533836-58533858 CTTTAAACCTTTCTGCAACAGGG + Intronic
1159498669 18:69239516-69239538 ACTGCATCCATTCTGCAACATGG - Intergenic
1159943004 18:74422923-74422945 CTTAAATCCTTTCTGGACCGAGG - Intergenic
1160298565 18:77658691-77658713 ATTGGACCCTTTCTGGAACTTGG - Intergenic
1162060897 19:8094589-8094611 CCTGCATCCTGGCTGGCACAAGG - Intronic
1162887472 19:13706530-13706552 CAAGCATCATTTCTGGAAAAAGG + Intergenic
1162913689 19:13863521-13863543 CTTGCCTCTTTTCTGTAAGAAGG + Intronic
1162962076 19:14134276-14134298 GTTAAATCCTTTCTGGAACAAGG - Intronic
1164418249 19:28063790-28063812 TTTGTATCCTTTCTGGGCCAGGG - Intergenic
1164502162 19:28829190-28829212 CTTGGATAATTTCTGGGACATGG - Intergenic
1164658914 19:29945389-29945411 CTTGTATGTTCTCTGGAACATGG + Intronic
1166142815 19:40814185-40814207 CTGTCAGCCTTTCTGGAACCTGG + Intronic
1166184742 19:41132617-41132639 CTGTCAGCCTTTCTGGAACCTGG - Intergenic
1166746744 19:45145390-45145412 CTTGCAGCCGTTCTGGATCTCGG - Exonic
926882626 2:17564022-17564044 CTGAAATCCTTTCTGAAACAAGG - Intronic
927607424 2:24499746-24499768 CTTAAATCCTTTTTGGAACATGG - Intronic
928095231 2:28400631-28400653 TTTGCCTCCTGTCTGAAACAAGG + Intronic
929049854 2:37826900-37826922 TGTGCTGCCTTTCTGGAACATGG - Intergenic
929586861 2:43121784-43121806 CTTCCATCCCATCTGGAACCAGG - Intergenic
929763255 2:44823660-44823682 CCTATATCCTTTTTGGAACAAGG - Intergenic
929875489 2:45793119-45793141 CTTAAATCTATTCTGGAACAAGG - Intronic
930899302 2:56484254-56484276 CTTTCATCTTTTTTGTAACATGG + Intergenic
931220339 2:60283621-60283643 TTTACATCCTTTCTGGAAGCTGG - Intergenic
931581092 2:63775672-63775694 CTTAGAGTCTTTCTGGAACAAGG + Intronic
931602954 2:64021658-64021680 TTGGAATCTTTTCTGGAACAAGG - Intergenic
932137931 2:69246911-69246933 CTCAGATCTTTTCTGGAACAAGG + Exonic
932598921 2:73111207-73111229 CTTGAATGTTTTCTGAAACATGG - Intronic
932668572 2:73717820-73717842 CTTCCAGCCTTGCAGGAACAGGG + Intergenic
933436940 2:82260576-82260598 CTCCCATCCTTTCTGGTCCAAGG - Intergenic
933808079 2:86014550-86014572 CTTTCTTCCTGTCTGGAACTTGG - Intergenic
933860965 2:86467404-86467426 ATTGTATCATTTCTGGAAAAAGG + Intronic
938664032 2:133515615-133515637 CTTGCATTCTTTCTGGCATATGG - Intronic
940771798 2:157846628-157846650 CTTAAATTGTTTCTGGAACAAGG - Intronic
941646000 2:168042233-168042255 CTTAAATCTTCTCTGGAACAAGG + Intronic
941765588 2:169293051-169293073 CTGACTTCCTTTCTGGAACCTGG - Intronic
942002698 2:171664588-171664610 CTTGGATCCTTTATGGAATGAGG - Intergenic
942153524 2:173103483-173103505 CTTAAATCCTTTTTGAAACAAGG - Intronic
942431037 2:175911813-175911835 CTTACATCCTGTGTGGAACAAGG - Intergenic
943192855 2:184703341-184703363 TATGCATGCTTTATGGAACAGGG - Intronic
943638923 2:190338155-190338177 CTTTTATCCTTACTGCAACAGGG - Intronic
943706981 2:191046314-191046336 CTTGAAGTCTTACTGGAACATGG + Intronic
944823086 2:203451316-203451338 CTTGCTTTCTTCTTGGAACATGG - Intronic
945111704 2:206366337-206366359 CTTCCATCCTTTTTGAGACAGGG + Intergenic
945185058 2:207131966-207131988 CATGCATCCTTTCTGCCACGAGG - Intronic
945854665 2:215054582-215054604 CATGCCTTCTTTCTGGAACTTGG + Exonic
946954539 2:224914667-224914689 CTTTCATCCTTTATGAAAGATGG - Intronic
947510117 2:230744662-230744684 CTTAAATTCTTTCTGGAACAAGG - Intronic
1172003306 20:31798617-31798639 CTTAGATCCTGTCTGGTACAAGG - Intronic
1172614896 20:36276718-36276740 CTTGAATCCTTTTTAGAGCAAGG - Intergenic
1173062055 20:39672011-39672033 ATTTTATCCTTTCTGTAACAAGG - Intergenic
1173705237 20:45105395-45105417 CCTGTGTCCTTCCTGGAACATGG - Intergenic
1174301954 20:49588977-49588999 CTGGCATGGTGTCTGGAACATGG - Intergenic
1174551955 20:51368615-51368637 CTCGCAGCGTGTCTGGAACACGG - Intergenic
1175886665 20:62295754-62295776 CTTGCAACCTTTCTTGGAGAAGG - Exonic
1178756843 21:35358690-35358712 GTTACATCCTTTGTGGAAGAAGG + Intronic
1178886845 21:36491605-36491627 CTGAAATCCTTTTTGGAACAAGG + Intronic
1179265704 21:39800885-39800907 CGTGCATTGTTTCTAGAACAGGG - Intronic
1181577710 22:23805933-23805955 CTTGCATCCTTTCTGGAACAGGG - Intronic
1183034626 22:35131894-35131916 CTTAAATCCTTTGGGGAACAAGG - Intergenic
1183121632 22:35734560-35734582 CTTGCCTCCTTTCTGTCACAGGG + Intergenic
1183296964 22:37035670-37035692 TTAGCATCCTCTCTGGCACATGG - Intergenic
1183316446 22:37139604-37139626 CTTGCATGCCTCCTGTAACAGGG - Intronic
1184371346 22:44084117-44084139 CCTCCATCCTTTCTGGGTCAAGG + Intronic
1184858380 22:47158834-47158856 CTTGCCTCCTTTCTGGACGCAGG - Intronic
1185185258 22:49395421-49395443 CTTGCATCCTTGCTGTACAATGG - Intergenic
951252243 3:20407445-20407467 CTAGCATTATTTCTGGCACATGG + Intergenic
954894241 3:53962551-53962573 CTTAAATCCTTTTTGGAACAAGG - Intergenic
955076931 3:55622730-55622752 CTTTAATCCTTTCTGGACCAAGG - Intronic
955977637 3:64493358-64493380 TTTGCATCCTTTCTGGAAGAGGG + Intergenic
959854542 3:111134980-111135002 TTTTTTTCCTTTCTGGAACATGG + Exonic
960597376 3:119418459-119418481 CTCGCATTCTAACTGGAACATGG - Exonic
960806909 3:121592883-121592905 CTTTCATCTTTCCTGGAAAAGGG - Intergenic
962167635 3:133066347-133066369 CCTAAATCCTTTCTAGAACAAGG - Intronic
962629151 3:137258459-137258481 CTTTCTTCCTTTCTGGGAAAGGG + Intergenic
962895905 3:139714607-139714629 CTTGCATATTTCCTGAAACATGG + Intergenic
963567872 3:146952953-146952975 CTGGCATCGTATCTGGTACATGG + Intergenic
963810935 3:149775717-149775739 CATTCATCCTTTCTGAAACAAGG - Intronic
965436891 3:168663421-168663443 CTTGCTTTCTTTATGGCACAGGG - Intergenic
966964557 3:184977684-184977706 CTAGCACCCTTTCTTGAATAGGG + Intronic
967323420 3:188216130-188216152 CTCAGATCATTTCTGGAACAAGG + Intronic
968309358 3:197670323-197670345 CTGGCATGGTGTCTGGAACACGG + Intergenic
969175378 4:5394990-5395012 CTGCACTCCTTTCTGGAACATGG + Intronic
969339291 4:6530253-6530275 CTTGGACCTTTTCTGAAACAAGG - Intronic
970058558 4:12003114-12003136 CTTGCTTCCTTTCTCCACCATGG + Intergenic
971304506 4:25467895-25467917 CTTGCTCCTTTTCTGAAACAAGG + Intergenic
972472118 4:39416052-39416074 TTTAAATCCTTTCTGGAACAAGG - Intronic
975222282 4:71826494-71826516 CTTGCACCATGTCTGGAACACGG + Intergenic
976350845 4:84058042-84058064 CTTAAATCCTTTCTGGGATAAGG + Intergenic
977321700 4:95524358-95524380 CTTGCATGTTTTATGCAACAGGG + Intronic
981013511 4:139950631-139950653 CTAGCAACCTTTCTGGAACTGGG + Intronic
985742902 5:1629964-1629986 CCTGAATTCTTTCTGGAATAAGG - Intergenic
986172225 5:5324375-5324397 TTTGCCTCCTTCATGGAACAAGG - Intergenic
987622516 5:20353822-20353844 CTTTCATCCTTTCTCCCACAGGG + Intronic
988830626 5:34983564-34983586 CTTAAATCCTTCTTGGAACAAGG - Intergenic
988841460 5:35087645-35087667 CTAGCATCCAGTCTGGAACTGGG - Intronic
990419610 5:55618461-55618483 ATTAGATCCTTTCTGGAACAAGG + Intergenic
990423053 5:55656653-55656675 CTTAAATCCTTTTTGGAGCAAGG + Intronic
990928016 5:61051731-61051753 CTTACATCCTTTCTGGAAGAAGG - Intronic
994009237 5:94880677-94880699 CTTGCATCATCTCTGCAACCAGG + Intronic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
995607860 5:113877291-113877313 CTGGCATCCTGTCAGGTACATGG + Intergenic
996919340 5:128749456-128749478 GTTGCCTGCTTTCTGGAAAATGG + Intronic
1001178368 5:169494545-169494567 AATCCATCCTTTCAGGAACAAGG - Intergenic
1001248203 5:170121675-170121697 CTTGAAACCTTTGTGGAAAAGGG - Intergenic
1002139312 5:177129179-177129201 CATGCTTCCTTTCTAGAAGATGG + Intergenic
1003894641 6:10595609-10595631 CTTAAGTCCTTTCTGGAACATGG - Intronic
1004358647 6:14951750-14951772 CTTCCATTCTTTCTGGATCCTGG - Intergenic
1006565650 6:34954509-34954531 CTTGCTGGCTTTGTGGAACAAGG + Intronic
1006641668 6:35492511-35492533 CTTCCCTCCTTCCTGGAACAGGG + Intronic
1006801582 6:36763231-36763253 CTTGGATCCTTGTTTGAACAAGG + Intronic
1007183196 6:39945580-39945602 TTTAAATCCTTTCTAGAACAAGG + Intergenic
1008078562 6:47171061-47171083 CTTGCCTCCTTTCTGTTACCAGG + Intergenic
1008421158 6:51300538-51300560 CTAGCATGCTGTCTGGCACATGG + Intergenic
1008632524 6:53376842-53376864 CTAGCATCCTGTCTGGAATGGGG - Intergenic
1010070777 6:71742065-71742087 CTTGCATGATAGCTGGAACAAGG + Intergenic
1011120753 6:83949617-83949639 ACTCCATCCTTTGTGGAACAAGG + Intronic
1011283670 6:85702272-85702294 CTTCCTTCCTTTTTGAAACAGGG + Intergenic
1012498768 6:99865075-99865097 TTTGCTTCCTTTGTGGAAGAAGG - Intergenic
1014802690 6:125794537-125794559 CTCATATCCTTTGTGGAACAAGG + Intronic
1015031975 6:128606123-128606145 CTTTCTTCCTTTTTGGTACATGG - Intergenic
1015562158 6:134527693-134527715 CTTGCTTCTTTTCTGTAAGAAGG - Intergenic
1015947674 6:138519977-138519999 CTTCAATCCTTTCTGAAACAAGG + Intronic
1016053584 6:139555286-139555308 CTTAAATCCTTTCTGGAACAAGG - Intergenic
1016486508 6:144545711-144545733 CTTGCATTCTATCAGGAAAATGG - Intronic
1017271783 6:152515587-152515609 CCTGCGTCCTGTCTGGAAGAGGG - Intronic
1017419174 6:154255561-154255583 CTTGCATCTTTTCTCAAGCATGG + Intronic
1018541016 6:164879191-164879213 TTTACCTCCTTTCTGGAAAAGGG + Intergenic
1019101221 6:169631745-169631767 CCTGCATCTTTTCTGGATAAAGG - Intronic
1019875589 7:3807827-3807849 TCTGCTTCCTTTCTGTAACATGG + Intronic
1021481237 7:21119914-21119936 CTTAAATCCTTCCTGGAGCAAGG - Intergenic
1022375959 7:29811327-29811349 CTTGAACACTTTATGGAACACGG - Intronic
1023028254 7:36071379-36071401 CTTTCTTCCTGTCTTGAACATGG + Intergenic
1024442876 7:49442134-49442156 CTTGCTTTTTTTCTAGAACATGG - Intergenic
1026676478 7:72432694-72432716 CTTGCATCCTTTCTGGAACAAGG + Intronic
1029059693 7:97784622-97784644 CTTGTATGCTTTCTGGAGCATGG + Intergenic
1029089700 7:98038691-98038713 CCAGCATTCTGTCTGGAACAGGG - Intergenic
1030024027 7:105304545-105304567 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030200106 7:106894209-106894231 CTTAAATCCTTTTTGGAACAAGG + Intronic
1030734541 7:113030862-113030884 GTGTCATCCTTTCTGGAAAAGGG + Intergenic
1034257575 7:149733077-149733099 CTTCCTTCCTTTCTGGAAGCTGG + Intronic
1034828958 7:154292354-154292376 CTTGCATCTTTTCTGGGATCTGG + Intronic
1036136830 8:6169759-6169781 CTTGCATCCTTTATTCAACAGGG - Intergenic
1037573754 8:20181035-20181057 CCTGCAGCCTTTATGGAAGAGGG + Exonic
1038392565 8:27217476-27217498 CCTGCATCTTTTCTGTAAAATGG - Intergenic
1038511739 8:28143838-28143860 CTTAAATCCTTTCTGGAACAAGG + Intronic
1040156753 8:44204467-44204489 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040170211 8:44403618-44403640 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040180583 8:44557119-44557141 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040196015 8:44785451-44785473 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040211542 8:45015811-45015833 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040229095 8:45274837-45274859 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1040243832 8:45492069-45492091 TTTGTAGCCTTTCTGGAAAAAGG + Intergenic
1041329622 8:56710660-56710682 CTTTCCTGCTTTCTGGAAAAGGG + Intergenic
1042121028 8:65488651-65488673 CTGTCATCCTTTCTAGAAAAAGG - Intergenic
1043551326 8:81376206-81376228 CATCCATCCCTTCTGGAATAGGG - Intergenic
1044745315 8:95365296-95365318 CCTAAATTCTTTCTGGAACAAGG - Intergenic
1045074668 8:98550820-98550842 CCTGCATGCTACCTGGAACAAGG + Intronic
1048303948 8:133270591-133270613 CCTGCATCCTACTTGGAACATGG + Intronic
1049343368 8:142125681-142125703 TTTAAATCCTTCCTGGAACACGG + Intergenic
1050112875 9:2234818-2234840 CTTGCCTCCCTTCTGCAGCAGGG + Intergenic
1051158294 9:14175570-14175592 CTTATATCCTCTCTGGAGCAAGG - Intronic
1052764642 9:32628860-32628882 CTTAAATCCTTCCTGGAACAAGG + Intergenic
1053109476 9:35445289-35445311 CTTAAATCCTTTATAGAACATGG - Intergenic
1058523640 9:105836318-105836340 CGTGAATCCTTTCTGGAAGAAGG + Intergenic
1058683943 9:107464743-107464765 CTGGGATCCTTTCTGGAAATTGG - Intergenic
1058923171 9:109637586-109637608 CTTACATCCTTTCTGGTATTAGG + Intergenic
1059497085 9:114718854-114718876 CATGCCTCCTTTCTGGACCAGGG + Intergenic
1060008166 9:120018790-120018812 GTCAAATCCTTTCTGGAACAAGG - Intergenic
1061105751 9:128529075-128529097 CTGAAATTCTTTCTGGAACAGGG + Intronic
1186489937 X:9963669-9963691 TTTGCATCTTTTCTGGAAAAAGG - Intergenic
1186767248 X:12783315-12783337 CTCAAATCCTTTCTGGAATAAGG - Intergenic
1187364680 X:18656720-18656742 CTTGCATGCTTTTTGGTACCAGG + Exonic
1187522135 X:20023105-20023127 CTTCCATACTTTCTGGAACAAGG - Intronic
1187947177 X:24437642-24437664 CTTAGATCCTTTCTGGAACAAGG - Intergenic
1188353977 X:29167128-29167150 CTTGCATCTTGTTTTGAACACGG + Intronic
1189402918 X:40689219-40689241 CTTAAATCCTTTCCAGAACATGG - Intronic
1190311840 X:49122440-49122462 GGTGCATCCTTTCTGGATCATGG + Exonic
1191109739 X:56795063-56795085 CATGCATGCTTACTGGAACGTGG + Intergenic
1191869591 X:65734768-65734790 CTTAAATCCTTTTTGGAACAAGG - Intronic
1192478599 X:71465511-71465533 ATTAAATCCTTCCTGGAACAAGG - Exonic
1192748954 X:73968195-73968217 ATTGCTTACTTTCTGGTACAAGG + Intergenic
1193364610 X:80616896-80616918 CTTTCATCAGTTCTGGAAAAAGG + Intergenic
1194859283 X:98976135-98976157 CTTGCATACTTTAAGTAACATGG - Intergenic
1195063128 X:101215947-101215969 TTTGCAACCTTACTGAAACATGG + Intergenic
1196760135 X:119193522-119193544 CATGCATAGTTTCTGGCACATGG - Intergenic
1198372632 X:136005745-136005767 CTTGCAGCCTTTCTCAAACAGGG + Intronic
1199363543 X:146950516-146950538 CTGGCATCTTTTCTGCAACTTGG - Intergenic
1200182414 X:154158830-154158852 CTTGCAGCTTTTCGGGAAGAAGG + Exonic
1200188068 X:154195944-154195966 CTTGCAGCTTTTCGGGAAGAAGG + Intergenic
1200193718 X:154233084-154233106 CTTGCAGCTTTTCGGGAAGAAGG + Exonic
1200199473 X:154270888-154270910 CTTGCAGCTTTTCGGGAAGAAGG + Exonic