ID: 1026678951 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:72450932-72450954 |
Sequence | AACTCTAAGGGACTGGAGAA AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1026678951_1026678959 | 21 | Left | 1026678951 | 7:72450932-72450954 | CCTTTCTCCAGTCCCTTAGAGTT | No data | ||
Right | 1026678959 | 7:72450976-72450998 | TTGCCACCATGACGGCCTTGTGG | 0: 1 1: 0 2: 0 3: 2 4: 85 |
||||
1026678951_1026678956 | 13 | Left | 1026678951 | 7:72450932-72450954 | CCTTTCTCCAGTCCCTTAGAGTT | No data | ||
Right | 1026678956 | 7:72450968-72450990 | CCCCATAGTTGCCACCATGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1026678951 | Original CRISPR | AACTCTAAGGGACTGGAGAA AGG (reversed) | Intergenic | ||