ID: 1026678951

View in Genome Browser
Species Human (GRCh38)
Location 7:72450932-72450954
Sequence AACTCTAAGGGACTGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026678951_1026678956 13 Left 1026678951 7:72450932-72450954 CCTTTCTCCAGTCCCTTAGAGTT No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678951_1026678959 21 Left 1026678951 7:72450932-72450954 CCTTTCTCCAGTCCCTTAGAGTT No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG 0: 1
1: 0
2: 0
3: 2
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026678951 Original CRISPR AACTCTAAGGGACTGGAGAA AGG (reversed) Intergenic