ID: 1026678952 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:72450939-72450961 |
Sequence | TTGAGAGAACTCTAAGGGAC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1026678952_1026678956 | 6 | Left | 1026678952 | 7:72450939-72450961 | CCAGTCCCTTAGAGTTCTCTCAA | No data | ||
Right | 1026678956 | 7:72450968-72450990 | CCCCATAGTTGCCACCATGACGG | No data | ||||
1026678952_1026678959 | 14 | Left | 1026678952 | 7:72450939-72450961 | CCAGTCCCTTAGAGTTCTCTCAA | No data | ||
Right | 1026678959 | 7:72450976-72450998 | TTGCCACCATGACGGCCTTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1026678952 | Original CRISPR | TTGAGAGAACTCTAAGGGAC TGG (reversed) | Intergenic | ||