ID: 1026678952

View in Genome Browser
Species Human (GRCh38)
Location 7:72450939-72450961
Sequence TTGAGAGAACTCTAAGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026678952_1026678956 6 Left 1026678952 7:72450939-72450961 CCAGTCCCTTAGAGTTCTCTCAA No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678952_1026678959 14 Left 1026678952 7:72450939-72450961 CCAGTCCCTTAGAGTTCTCTCAA No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026678952 Original CRISPR TTGAGAGAACTCTAAGGGAC TGG (reversed) Intergenic