ID: 1026678956

View in Genome Browser
Species Human (GRCh38)
Location 7:72450968-72450990
Sequence CCCCATAGTTGCCACCATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026678954_1026678956 0 Left 1026678954 7:72450945-72450967 CCTTAGAGTTCTCTCAATCATGT No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678952_1026678956 6 Left 1026678952 7:72450939-72450961 CCAGTCCCTTAGAGTTCTCTCAA No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678949_1026678956 25 Left 1026678949 7:72450920-72450942 CCTCAACTCTGCCCTTTCTCCAG No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678953_1026678956 1 Left 1026678953 7:72450944-72450966 CCCTTAGAGTTCTCTCAATCATG No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678951_1026678956 13 Left 1026678951 7:72450932-72450954 CCTTTCTCCAGTCCCTTAGAGTT No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
1026678950_1026678956 14 Left 1026678950 7:72450931-72450953 CCCTTTCTCCAGTCCCTTAGAGT No data
Right 1026678956 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026678956 Original CRISPR CCCCATAGTTGCCACCATGA CGG Intergenic