ID: 1026678959

View in Genome Browser
Species Human (GRCh38)
Location 7:72450976-72450998
Sequence TTGCCACCATGACGGCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026678954_1026678959 8 Left 1026678954 7:72450945-72450967 CCTTAGAGTTCTCTCAATCATGT No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data
1026678950_1026678959 22 Left 1026678950 7:72450931-72450953 CCCTTTCTCCAGTCCCTTAGAGT No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data
1026678953_1026678959 9 Left 1026678953 7:72450944-72450966 CCCTTAGAGTTCTCTCAATCATG No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data
1026678952_1026678959 14 Left 1026678952 7:72450939-72450961 CCAGTCCCTTAGAGTTCTCTCAA No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data
1026678951_1026678959 21 Left 1026678951 7:72450932-72450954 CCTTTCTCCAGTCCCTTAGAGTT No data
Right 1026678959 7:72450976-72450998 TTGCCACCATGACGGCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026678959 Original CRISPR TTGCCACCATGACGGCCTTG TGG Intergenic