ID: 1026678963

View in Genome Browser
Species Human (GRCh38)
Location 7:72450993-72451015
Sequence TTGTGGAAGCTCTGTGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026678955_1026678963 2 Left 1026678955 7:72450968-72450990 CCCCATAGTTGCCACCATGACGG No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data
1026678960_1026678963 -9 Left 1026678960 7:72450979-72451001 CCACCATGACGGCCTTGTGGAAG No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data
1026678958_1026678963 0 Left 1026678958 7:72450970-72450992 CCATAGTTGCCACCATGACGGCC No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data
1026678957_1026678963 1 Left 1026678957 7:72450969-72450991 CCCATAGTTGCCACCATGACGGC No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data
1026678953_1026678963 26 Left 1026678953 7:72450944-72450966 CCCTTAGAGTTCTCTCAATCATG No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data
1026678954_1026678963 25 Left 1026678954 7:72450945-72450967 CCTTAGAGTTCTCTCAATCATGT No data
Right 1026678963 7:72450993-72451015 TTGTGGAAGCTCTGTGCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026678963 Original CRISPR TTGTGGAAGCTCTGTGCCCC AGG Intergenic