ID: 1026680224

View in Genome Browser
Species Human (GRCh38)
Location 7:72461027-72461049
Sequence ATGGAGAGAAGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026680224_1026680233 1 Left 1026680224 7:72461027-72461049 CCTTCCTCCTTCCTTCTCTCCAT No data
Right 1026680233 7:72461051-72461073 CCATTCCCTAGGCTGTGAGGAGG No data
1026680224_1026680228 -10 Left 1026680224 7:72461027-72461049 CCTTCCTCCTTCCTTCTCTCCAT No data
Right 1026680228 7:72461040-72461062 TTCTCTCCATCCCATTCCCTAGG No data
1026680224_1026680230 -2 Left 1026680224 7:72461027-72461049 CCTTCCTCCTTCCTTCTCTCCAT No data
Right 1026680230 7:72461048-72461070 ATCCCATTCCCTAGGCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026680224 Original CRISPR ATGGAGAGAAGGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr