ID: 1026680540

View in Genome Browser
Species Human (GRCh38)
Location 7:72463320-72463342
Sequence CCATCTGTACTAAAAGTACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026680540_1026680545 -7 Left 1026680540 7:72463320-72463342 CCAGGTACTTTTAGTACAGATGG No data
Right 1026680545 7:72463336-72463358 CAGATGGGGTTTCACCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026680540 Original CRISPR CCATCTGTACTAAAAGTACC TGG (reversed) Intergenic
No off target data available for this crispr