ID: 1026680783 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:72465001-72465023 |
| Sequence | GGTCCCAGAGGAACACCCAC TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026680778_1026680783 | 3 | Left | 1026680778 | 7:72464975-72464997 | CCAACTGTACTCAGGCACAGCCT | No data | ||
| Right | 1026680783 | 7:72465001-72465023 | GGTCCCAGAGGAACACCCACTGG | No data | ||||
| 1026680775_1026680783 | 22 | Left | 1026680775 | 7:72464956-72464978 | CCATGTCCTCTTGATGTCTCCAA | No data | ||
| Right | 1026680783 | 7:72465001-72465023 | GGTCCCAGAGGAACACCCACTGG | No data | ||||
| 1026680776_1026680783 | 16 | Left | 1026680776 | 7:72464962-72464984 | CCTCTTGATGTCTCCAACTGTAC | No data | ||
| Right | 1026680783 | 7:72465001-72465023 | GGTCCCAGAGGAACACCCACTGG | No data | ||||
| 1026680774_1026680783 | 25 | Left | 1026680774 | 7:72464953-72464975 | CCTCCATGTCCTCTTGATGTCTC | No data | ||
| Right | 1026680783 | 7:72465001-72465023 | GGTCCCAGAGGAACACCCACTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026680783 | Original CRISPR | GGTCCCAGAGGAACACCCAC TGG | Intergenic | ||