ID: 1026680783

View in Genome Browser
Species Human (GRCh38)
Location 7:72465001-72465023
Sequence GGTCCCAGAGGAACACCCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026680775_1026680783 22 Left 1026680775 7:72464956-72464978 CCATGTCCTCTTGATGTCTCCAA No data
Right 1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG No data
1026680774_1026680783 25 Left 1026680774 7:72464953-72464975 CCTCCATGTCCTCTTGATGTCTC No data
Right 1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG No data
1026680776_1026680783 16 Left 1026680776 7:72464962-72464984 CCTCTTGATGTCTCCAACTGTAC No data
Right 1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG No data
1026680778_1026680783 3 Left 1026680778 7:72464975-72464997 CCAACTGTACTCAGGCACAGCCT No data
Right 1026680783 7:72465001-72465023 GGTCCCAGAGGAACACCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026680783 Original CRISPR GGTCCCAGAGGAACACCCAC TGG Intergenic
No off target data available for this crispr