ID: 1026681632

View in Genome Browser
Species Human (GRCh38)
Location 7:72471530-72471552
Sequence GAACCCCATGGACACCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026681632_1026681636 21 Left 1026681632 7:72471530-72471552 CCAAAGTGGTGTCCATGGGGTTC No data
Right 1026681636 7:72471574-72471596 TTCCAAACTGAAATGTATGCAGG No data
1026681632_1026681639 29 Left 1026681632 7:72471530-72471552 CCAAAGTGGTGTCCATGGGGTTC No data
Right 1026681639 7:72471582-72471604 TGAAATGTATGCAGGTCCACGGG No data
1026681632_1026681638 28 Left 1026681632 7:72471530-72471552 CCAAAGTGGTGTCCATGGGGTTC No data
Right 1026681638 7:72471581-72471603 CTGAAATGTATGCAGGTCCACGG No data
1026681632_1026681635 -10 Left 1026681632 7:72471530-72471552 CCAAAGTGGTGTCCATGGGGTTC No data
Right 1026681635 7:72471543-72471565 CATGGGGTTCTTGCTTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026681632 Original CRISPR GAACCCCATGGACACCACTT TGG (reversed) Intergenic
No off target data available for this crispr