ID: 1026681752

View in Genome Browser
Species Human (GRCh38)
Location 7:72472290-72472312
Sequence GTGGATGAATGCATGGTCAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026681750_1026681752 -10 Left 1026681750 7:72472277-72472299 CCTTGTTGAGCAAGTGGATGAAT No data
Right 1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG No data
1026681746_1026681752 20 Left 1026681746 7:72472247-72472269 CCTGAGCCTGGCATTTGCAAGGC No data
Right 1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG No data
1026681747_1026681752 14 Left 1026681747 7:72472253-72472275 CCTGGCATTTGCAAGGCCATACA No data
Right 1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG No data
1026681744_1026681752 25 Left 1026681744 7:72472242-72472264 CCGTTCCTGAGCCTGGCATTTGC No data
Right 1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG No data
1026681748_1026681752 -2 Left 1026681748 7:72472269-72472291 CCATACATCCTTGTTGAGCAAGT No data
Right 1026681752 7:72472290-72472312 GTGGATGAATGCATGGTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026681752 Original CRISPR GTGGATGAATGCATGGTCAA TGG Intergenic
No off target data available for this crispr