ID: 1026685454

View in Genome Browser
Species Human (GRCh38)
Location 7:72505511-72505533
Sequence CTGGAGAAACAGAAAGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026685444_1026685454 22 Left 1026685444 7:72505466-72505488 CCTTCTAGAGGTCTCCCTGGGAG No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data
1026685446_1026685454 8 Left 1026685446 7:72505480-72505502 CCCTGGGAGCCAGAGGTACCACA No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data
1026685441_1026685454 30 Left 1026685441 7:72505458-72505480 CCAGGCTGCCTTCTAGAGGTCTC No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data
1026685447_1026685454 7 Left 1026685447 7:72505481-72505503 CCTGGGAGCCAGAGGTACCACAA No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data
1026685451_1026685454 -10 Left 1026685451 7:72505498-72505520 CCACAAGGCAAACCTGGAGAAAC No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data
1026685449_1026685454 -1 Left 1026685449 7:72505489-72505511 CCAGAGGTACCACAAGGCAAACC No data
Right 1026685454 7:72505511-72505533 CTGGAGAAACAGAAAGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026685454 Original CRISPR CTGGAGAAACAGAAAGAGGC TGG Intergenic
No off target data available for this crispr