ID: 1026688297

View in Genome Browser
Species Human (GRCh38)
Location 7:72531490-72531512
Sequence CAGGCGCCTGGGCCTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026688297_1026688303 14 Left 1026688297 7:72531490-72531512 CCTCAACCAGGCCCAGGCGCCTG No data
Right 1026688303 7:72531527-72531549 GAAGTTGCTACCCCTACCCCAGG No data
1026688297_1026688307 29 Left 1026688297 7:72531490-72531512 CCTCAACCAGGCCCAGGCGCCTG No data
Right 1026688307 7:72531542-72531564 ACCCCAGGTGAAAGTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026688297 Original CRISPR CAGGCGCCTGGGCCTGGTTG AGG (reversed) Intergenic
No off target data available for this crispr