ID: 1026697640

View in Genome Browser
Species Human (GRCh38)
Location 7:72609847-72609869
Sequence CCTTCCAATTATGTGTTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 2, 1: 0, 2: 2, 3: 13, 4: 289}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026697640_1026697642 7 Left 1026697640 7:72609847-72609869 CCAGAAAACACATAATTGGAAGG 0: 2
1: 0
2: 2
3: 13
4: 289
Right 1026697642 7:72609877-72609899 ATGAGCCTTGTTTTACTTTTTGG No data
1026697640_1026697643 11 Left 1026697640 7:72609847-72609869 CCAGAAAACACATAATTGGAAGG 0: 2
1: 0
2: 2
3: 13
4: 289
Right 1026697643 7:72609881-72609903 GCCTTGTTTTACTTTTTGGATGG 0: 1
1: 1
2: 4
3: 31
4: 427
1026697640_1026697645 12 Left 1026697640 7:72609847-72609869 CCAGAAAACACATAATTGGAAGG 0: 2
1: 0
2: 2
3: 13
4: 289
Right 1026697645 7:72609882-72609904 CCTTGTTTTACTTTTTGGATGGG 0: 1
1: 1
2: 4
3: 34
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026697640 Original CRISPR CCTTCCAATTATGTGTTTTC TGG (reversed) Intronic
900913122 1:5616338-5616360 AATTGCAATTATTTGTTTTCCGG + Intergenic
902460352 1:16570627-16570649 TCTGACAATTATGTGTTTTGGGG - Intronic
904766525 1:32853002-32853024 ACGTCAAAGTATGTGTTTTCAGG - Intronic
907769466 1:57446037-57446059 CCATCCAATTTTATGATTTCAGG + Intronic
908097604 1:60755976-60755998 TCTTCTATTTTTGTGTTTTCTGG + Intergenic
908593043 1:65653654-65653676 TCTGACAATTATGTGTTTTGGGG - Intergenic
909176683 1:72370674-72370696 CCTGCCATCTATGTGTTTCCAGG + Intergenic
909456946 1:75860723-75860745 TCTGCCAATTATGTGTCTTGGGG + Intronic
910012798 1:82486273-82486295 CCTTCCCATTCTTTCTTTTCAGG - Intergenic
910020474 1:82583569-82583591 TATTCCAATTATATTTTTTCTGG + Intergenic
911984486 1:104603188-104603210 CCTTCTGTTTATGTATTTTCTGG - Intergenic
912856094 1:113169896-113169918 CCTTCCAAATCTGTCTTCTCCGG + Intergenic
912966431 1:114241254-114241276 TCTGCCAATTATGTGTCTTGGGG - Intergenic
912995732 1:114530910-114530932 CCTGCTAACTCTGTGTTTTCTGG + Intergenic
914337505 1:146729066-146729088 CATTACCATTATGTGTTTTCAGG + Intergenic
915799293 1:158771890-158771912 TGTTTCAATTATGTGTTTTATGG + Intergenic
915847413 1:159281351-159281373 GCTTCCAATTATTTATTTTAAGG + Intergenic
916379381 1:164192060-164192082 CCATTCTATTATTTGTTTTCTGG - Intergenic
917609005 1:176667387-176667409 CCTTTCATTTTTCTGTTTTCTGG - Intronic
917950256 1:180025587-180025609 GCTTCCAAAAATGTTTTTTCTGG + Intronic
919594160 1:199540896-199540918 CCATGCAATTATGTGGTTTGGGG - Intergenic
920331131 1:205209381-205209403 CCTTCCCATCAGCTGTTTTCTGG + Intronic
920598493 1:207297742-207297764 CTTTCCAATTGTGTGTTCTTGGG + Intergenic
921052581 1:211521575-211521597 CTTTCCAAAAATGTGTTATCAGG + Intergenic
921975716 1:221200763-221200785 CCTTCCCATTAGGAGATTTCTGG + Intergenic
1065078682 10:22106271-22106293 CCTTCTCATTAGCTGTTTTCTGG + Intergenic
1065791216 10:29262583-29262605 CCTTCCAACTCTGTGGTTACAGG + Intergenic
1065901723 10:30214035-30214057 CCTACCCATTGGGTGTTTTCTGG + Intergenic
1066655380 10:37694505-37694527 TCTGACAATTATGTGTTTTGGGG - Intergenic
1067239924 10:44481991-44482013 TCTGACAATTATGTGTTTTGGGG - Intergenic
1069629080 10:69886987-69887009 CCTTCAAAATGTGTGTTTTCAGG - Intronic
1070234285 10:74607692-74607714 TCTGACAATTATGTGTTTTGGGG + Intronic
1070704450 10:78627637-78627659 CCAGCCAATTCTGTCTTTTCGGG - Intergenic
1070948685 10:80413668-80413690 CTTTCCATTTAGATGTTTTCTGG + Intronic
1072024613 10:91442542-91442564 CCTGACAATTATGTGTCTTGGGG + Intronic
1072025084 10:91447053-91447075 CCTGACAATTATGTGTCTTGGGG - Intronic
1072913786 10:99524695-99524717 CCATCAAATTTTGTGTTTTTGGG - Intergenic
1073165412 10:101444758-101444780 CCTTCAGATTTTTTGTTTTCAGG - Intronic
1073869158 10:107842347-107842369 CCTTGCAACTATGGGTTTCCAGG - Intergenic
1074142041 10:110681541-110681563 CCTTCCAATGGTGTCTTTACAGG - Intronic
1074308156 10:112298125-112298147 CCTTCCAATTCAATGCTTTCCGG + Exonic
1074748904 10:116564753-116564775 CCTTCCAATAGTATATTTTCAGG - Intronic
1075780568 10:125014692-125014714 CCTTCCAAGTCAGTGCTTTCTGG - Intronic
1076073744 10:127515016-127515038 CATTCTACTTCTGTGTTTTCTGG + Intergenic
1078743246 11:14088592-14088614 TCTGACAATTATGTGTTTTGGGG + Intronic
1079337703 11:19585841-19585863 CCTGACAATTATGTGTCTTGGGG + Intronic
1079558322 11:21789749-21789771 CCTTCCAATTTTTTGTTTTCTGG + Intergenic
1082619624 11:55404071-55404093 ACTTCCCATTATGAATTTTCTGG + Intergenic
1083296102 11:61716447-61716469 CCTTCCAGTGATGTGTTTCTGGG + Intronic
1084598549 11:70131622-70131644 CCGTCCCATTGTGTGTTTTAAGG + Intronic
1085683621 11:78601905-78601927 CCTGACAATTATGTGTCTTGGGG + Intergenic
1085909513 11:80804703-80804725 CATTTTAAATATGTGTTTTCAGG + Intergenic
1086253751 11:84848991-84849013 ACTTCTAATTTTGTGTTTTAGGG + Intronic
1086827044 11:91511113-91511135 ACTTCCAATTCTGTATCTTCTGG - Intergenic
1087032843 11:93723268-93723290 CCTTGCAAATCTGTTTTTTCAGG - Exonic
1087653881 11:100900368-100900390 TCTGACAATTATGTGTTTTGGGG + Intronic
1087825663 11:102762258-102762280 CCTTCCAATTCAATGGTTTCTGG - Intergenic
1088055460 11:105571153-105571175 CCTTCCGATTATGAGTCTTAAGG - Intergenic
1088831339 11:113539471-113539493 CCTTGCTATGATGTATTTTCTGG - Intergenic
1089041887 11:115459664-115459686 CCTTCCAATTTAGTCTCTTCAGG - Intronic
1089847453 11:121469560-121469582 TGTTCCAACTATGTTTTTTCTGG - Intronic
1090216160 11:124967097-124967119 TCTGACAATTATGTGTTTTGGGG + Intronic
1090312869 11:125757587-125757609 TCTGACAATTATGTGTTTTGGGG - Intergenic
1090602968 11:128391686-128391708 CCTTCCTAGTGTGTGTTCTCTGG - Intergenic
1092897855 12:13030743-13030765 CCTTGCAATTAAGTGTCTGCAGG + Intergenic
1094758028 12:33494253-33494275 CCTATCAATTATGTGTCTTGGGG - Intergenic
1094795652 12:33968947-33968969 TCTTCTAATTTTGTATTTTCAGG - Intergenic
1095108441 12:38263168-38263190 TCTTCTAATTTTGTATTTTCAGG - Intergenic
1096273224 12:50183410-50183432 ACTTACCATCATGTGTTTTCTGG - Intronic
1096752708 12:53772234-53772256 CCTCTCAAAAATGTGTTTTCAGG + Intergenic
1097139624 12:56889558-56889580 TCTTACAATTATGTGTCTTGGGG - Intergenic
1099110672 12:78556485-78556507 CTTTCCATTTTTCTGTTTTCAGG - Intergenic
1099268187 12:80474965-80474987 CCTGCCAACTTTGTGTTTTCAGG + Intronic
1099498103 12:83377614-83377636 CATGACAATTATGTGTTTTGGGG + Intergenic
1099720693 12:86358009-86358031 TCTGACAATTATGTGTTTTGGGG - Intronic
1099892397 12:88606004-88606026 TCTGACAATTATGTGTCTTCAGG - Intergenic
1100135391 12:91546740-91546762 CCTGACAATTATGTGTCTTGGGG - Intergenic
1100136450 12:91558468-91558490 CCTGACAATTATGTGTCTTGGGG - Intergenic
1100200212 12:92290164-92290186 CTTTTCAATTAGGTGATTTCTGG + Intergenic
1100911924 12:99374168-99374190 CCATTCATTTATGTATTTTCTGG - Intronic
1101726310 12:107391312-107391334 AATTCCAATTATGTGCATTCTGG + Intronic
1102049316 12:109850846-109850868 CCTACCAAGAATGTATTTTCTGG - Intergenic
1107021216 13:35753921-35753943 CCATTTTATTATGTGTTTTCTGG + Intergenic
1107153540 13:37140212-37140234 CCTTTCACTTCTGTGTTTTCTGG + Intergenic
1107239686 13:38217246-38217268 CCTTCTAGTTCTGTTTTTTCTGG + Intergenic
1107442864 13:40443841-40443863 ACTTCCAATGATGTGCTTGCAGG + Intergenic
1107660143 13:42630762-42630784 TCTTCCAATACTGTGTTTTGGGG + Intergenic
1108194100 13:47974217-47974239 TCTTTCAAATATCTGTTTTCAGG - Intronic
1108680139 13:52773046-52773068 ACTCCCAATTCTGTGTTTTTTGG - Intergenic
1111633863 13:90878159-90878181 CCTCTCAATTAACTGTTTTCTGG - Intergenic
1114415693 14:22542186-22542208 CCATCTGATTGTGTGTTTTCTGG + Intergenic
1115145652 14:30223113-30223135 CCTTCCAATTCTTATTTTTCAGG + Intergenic
1116729909 14:48608382-48608404 CCTGACAATTATGTGTCTTGGGG - Intergenic
1117822027 14:59659420-59659442 CCTGACAATTATGTGTCTTGGGG - Intronic
1118114039 14:62754351-62754373 CCTTTTTGTTATGTGTTTTCTGG - Intronic
1118511975 14:66485022-66485044 ACTCCAAATTATGTGTTTTAGGG - Intergenic
1119373625 14:74169373-74169395 CCTTCCTTTTCTGTGTATTCTGG + Intronic
1122402149 14:101473868-101473890 CCTTCCAATTCTGTTCTTTGTGG + Intergenic
1123924720 15:25096658-25096680 CCTTCTAATTGTGATTTTTCCGG + Intergenic
1127218499 15:56850711-56850733 CCTTCCTATTTTTAGTTTTCTGG - Intronic
1127597555 15:60501727-60501749 CTTTCACATTCTGTGTTTTCAGG - Intronic
1127745287 15:61963704-61963726 CAATCCAATTACGTCTTTTCAGG + Intronic
1130703515 15:86210276-86210298 CCTGACAATTATGTGTCTTGGGG + Intronic
1134137534 16:11688107-11688129 CTTTCCAATACTGTGCTTTCTGG + Intronic
1135380293 16:21990470-21990492 CCTTGTAAGTATTTGTTTTCTGG - Intronic
1135712779 16:24731661-24731683 CCTTCCATTTTTGTTTTATCAGG + Intronic
1135831082 16:25773995-25774017 CATTCCAAATGTCTGTTTTCTGG + Intronic
1137046283 16:35665433-35665455 TCTGACAATTATGTGTTTTGGGG - Intergenic
1138131306 16:54482389-54482411 CCTTCCAATTCTGTCTCTTGAGG - Intergenic
1139996776 16:70988262-70988284 CATTACCATTATGTGTTTTCAGG - Intronic
1140675108 16:77320305-77320327 CCTTCCAACTATGTTTTCTGTGG + Intronic
1144135238 17:12289074-12289096 ACTTCCACTTATCTTTTTTCAGG + Intergenic
1148212231 17:45815440-45815462 CCTTCCAAATATTTGCTTTTTGG - Intronic
1148295374 17:46497325-46497347 CCTTTTTATTATTTGTTTTCTGG + Intergenic
1149275884 17:55035473-55035495 GCATACAATTATGTGTTATCAGG - Intronic
1149976960 17:61275684-61275706 CCTTCAAATTATCTGACTTCTGG - Intronic
1150407224 17:64912612-64912634 CCTTTTTATTATTTGTTTTCTGG - Intronic
1152527669 17:80898592-80898614 CCTTCCTAATGTGTGTGTTCAGG + Intronic
1155911654 18:31511216-31511238 CCTTACAACTAAGTGTTATCTGG - Intronic
1156104573 18:33643620-33643642 CCTTGCTATTAAGTGTGTTCTGG + Intronic
1157891677 18:51424095-51424117 CCTTCCAATCTTGTGTTTCAGGG + Intergenic
1161373687 19:3927948-3927970 CCTTCCAACGATGAGTTTTGCGG + Exonic
1161789790 19:6352679-6352701 ACTTCCAGTTATTTGTTTTTAGG - Intergenic
1162669682 19:12245245-12245267 CATTGCAATTATGCATTTTCAGG - Intronic
1163976081 19:20853734-20853756 TCTGCCAATGATGTGTCTTCAGG - Intronic
1164416776 19:28052383-28052405 CCTGACAATTATGTGTCTTGGGG - Intergenic
1164893250 19:31843286-31843308 CTTTCTAATTATGATTTTTCTGG - Intergenic
1167259008 19:48447233-48447255 CCTTCTAATTTTTTGTTTTTTGG + Intronic
1168604554 19:57747956-57747978 CCTTCCAAGTATGTTTATACTGG - Intronic
1202676786 1_KI270711v1_random:14355-14377 TCTGACAATTATGTGTTTTGGGG - Intergenic
926647567 2:15305791-15305813 CCTTCCAATCTTATGTATTCAGG + Intronic
926966084 2:18413069-18413091 CTTACCAACTATGTGTTTTGGGG - Intergenic
927152612 2:20204480-20204502 CCTTCCCATTGTGTGTGTCCAGG + Intronic
929062737 2:37940343-37940365 TCTGACAATTATGTGTTTTGGGG + Intronic
929352682 2:40978208-40978230 CCTGCGAATCATGTGTCTTCAGG - Intergenic
931181479 2:59905611-59905633 TATGTCAATTATGTGTTTTCAGG - Intergenic
931211925 2:60205785-60205807 TCTGACAATTATGTGTTTTGGGG + Intergenic
933391605 2:81675964-81675986 CTTTCTAATCATGGGTTTTCAGG - Intergenic
933906300 2:86897048-86897070 CCTTCCACTTTTGTGTTATGGGG - Intergenic
933968938 2:87454250-87454272 CCTTGCAGTTTTGTGTTTTATGG - Intergenic
935373857 2:102375496-102375518 CAGTCCAATTTTGTGTATTCTGG - Intronic
935472307 2:103475132-103475154 TCTGCCAATTATGTGTCTTGGGG + Intergenic
936324855 2:111496257-111496279 CCTTGCAGTTTTGTGTTTTATGG + Intergenic
938839796 2:135149153-135149175 CCTTCCCATCCTGTGATTTCAGG + Intronic
939193241 2:138941412-138941434 TCTGACAATTATGTGTTTTGGGG + Intergenic
939473584 2:142656618-142656640 ACTTAAAATTATGGGTTTTCTGG - Intergenic
939849858 2:147291489-147291511 CTTTCTAAATATATGTTTTCTGG - Intergenic
941276763 2:163499346-163499368 TCTGCCAATTATGTGTCTTGGGG - Intergenic
942539093 2:176996424-176996446 CCTTGCAATTTTATGTATTCTGG - Intergenic
945625513 2:212200157-212200179 CCTTCCTATTTTATGTTGTCTGG - Intronic
946480311 2:220049384-220049406 CCTTTCACTTAGGTTTTTTCAGG + Intergenic
948758654 2:240175608-240175630 AGTTCCAATTATTTGTTTCCAGG + Intergenic
1169864482 20:10185291-10185313 CCCTTTAATTATGTGCTTTCTGG + Intergenic
1169960172 20:11151244-11151266 TCTACCAATTATGTGTCTTGGGG + Intergenic
1170297263 20:14841505-14841527 CCTTTCAAGTAGATGTTTTCAGG + Intronic
1171124684 20:22591265-22591287 CCCTCCTATGCTGTGTTTTCCGG + Intergenic
1173326991 20:42042940-42042962 CCATCCAGGTATGTGCTTTCAGG + Intergenic
1177260105 21:18719039-18719061 TCTTCCAAATATTTTTTTTCAGG - Intergenic
1177278585 21:18948914-18948936 CCTTCCAATGATCTGTTTTGTGG + Intergenic
1177744013 21:25188606-25188628 CCATCCATTTATGTTTCTTCAGG - Intergenic
1178610588 21:34075155-34075177 CCTTCAACTTACGTGTTTTAGGG + Intronic
1180724170 22:17932158-17932180 TCTGCCAATTATGTGTCTTGGGG - Intronic
949456473 3:4244717-4244739 TCTGACAATTATGTGTCTTCAGG + Intronic
950074642 3:10178530-10178552 CCCTCCAATACTGTGTTCTCTGG - Intronic
951653559 3:24980231-24980253 TCTGACAATTATGTGTCTTCGGG + Intergenic
952644698 3:35640603-35640625 CTTTCCATTTCTGTCTTTTCTGG - Intronic
952872389 3:37912285-37912307 CCTTCCAGGCATGTGTTTACAGG + Intronic
955704479 3:61714059-61714081 CCTTTCTAATATGTCTTTTCTGG + Intronic
957658493 3:83114815-83114837 GCTTCCAATTCAATGTTTTCTGG + Intergenic
957839949 3:85655032-85655054 CCTTACAATTTTTTGTTTCCTGG - Intronic
958510560 3:95041565-95041587 CTTTCCCATCATGTGTATTCAGG + Intergenic
959724015 3:109523427-109523449 TCTTACAATTATGTGTCTTGGGG - Intergenic
960394379 3:117118306-117118328 CCTTGCTATTTTGTGTTTCCGGG + Intronic
962656129 3:137545369-137545391 TCTGCCAATTATGTGTCTTGGGG - Intergenic
963905743 3:150772293-150772315 CCAGCCTATTATGTGTTTTAAGG + Intergenic
963984284 3:151574178-151574200 CCTGACAATTATGTGTCTTGGGG + Intergenic
965468291 3:169059563-169059585 ACCTCCCATTATGTCTTTTCAGG + Intergenic
966070336 3:175869737-175869759 CTTTATTATTATGTGTTTTCTGG - Intergenic
966191340 3:177274266-177274288 TCTTCCTATTATGTGATGTCTGG + Intergenic
966574050 3:181479314-181479336 TCTGACAATTATGTGTCTTCGGG - Intergenic
967411814 3:189173825-189173847 TCTTCCAATTAAGAGTTTTAGGG + Intronic
969189766 4:5507785-5507807 CCTTCCCATCATATCTTTTCAGG - Intergenic
970067325 4:12113702-12113724 CCATGTAATTATGTGGTTTCAGG + Intergenic
970204802 4:13645176-13645198 CCTTCCAACCCTGTGTTCTCTGG - Intergenic
971230187 4:24795383-24795405 CCTCCCATTTTTGGGTTTTCGGG - Intronic
971234996 4:24833283-24833305 CCATCCAATTTTATGTTTTAAGG - Intronic
972126631 4:35774901-35774923 CTTTTCAATTATATGTTTACTGG - Intergenic
973088136 4:46094832-46094854 CCTTTTAATTTTGTGGTTTCTGG - Intronic
974178830 4:58359493-58359515 CTTTCCACTTATGTGTTCTATGG - Intergenic
974660911 4:64887670-64887692 CTTTCCATTTATGTGTTCACTGG + Intergenic
974837851 4:67272642-67272664 TCTGACAATTATGTGTCTTCAGG + Intergenic
975528882 4:75379789-75379811 TCTGACAATTATGTGTTTTGGGG - Intergenic
975843871 4:78505187-78505209 TCTGACAATTATGTGTTTTGGGG + Intronic
976669673 4:87637811-87637833 CCTGACAATTATGTGTCTTGGGG - Intergenic
977793105 4:101130431-101130453 TCTGACAATTATGTGTTTTAGGG - Intronic
977906134 4:102479574-102479596 TCTTACAATTATGTGTCTTGGGG - Intergenic
978653261 4:111034075-111034097 TCTTCCAATTATTTTTTTCCTGG + Intergenic
979606304 4:122642477-122642499 CCTTCCAATGAGGTATTTTAGGG + Intergenic
980960722 4:139471628-139471650 CCCTCCAATTTTGTTTGTTCAGG + Intronic
981042087 4:140232885-140232907 ACTTCCAAATACTTGTTTTCTGG - Intergenic
982191314 4:152858356-152858378 CCTTCCTATTTTGTTTTTTATGG + Intronic
983333556 4:166362123-166362145 TCTCCCAATTTTGTGTTTTGTGG + Intergenic
983472626 4:168175333-168175355 GCTTCCAATTATTTGTTTCTTGG + Intronic
983841027 4:172456882-172456904 TCTGACAATTATGTGTTTTGGGG - Intronic
984353837 4:178632338-178632360 CCTTCCACTTATTTGGTTTTAGG + Intergenic
985097464 4:186427494-186427516 CCCTCCAATTATATGATGTCAGG + Intronic
985278937 4:188268568-188268590 CCTTGCAAATATGTGTTCACAGG - Intergenic
985309698 4:188583732-188583754 CCTGCTCATTTTGTGTTTTCAGG + Intergenic
986626413 5:9727104-9727126 CCATCCAAGCATGTGTTTTGTGG - Intergenic
986833456 5:11608188-11608210 ACTTTCAACTATGTGTTTTCTGG - Intronic
987725510 5:21694227-21694249 TCTTCCCATTCTGTGTTTTCAGG + Intergenic
989683527 5:44058129-44058151 GCTTACACTTATGTGTTTTGAGG + Intergenic
991482259 5:67093608-67093630 CTTTCTAGTTGTGTGTTTTCTGG + Intronic
992138906 5:73775902-73775924 GATTCAAATTATGTGTTTTTTGG - Intronic
997570267 5:134921921-134921943 CCTTCCAATTATATTTTATAGGG + Intronic
997571071 5:134927962-134927984 GATTCAAATTATGTGTTTTTTGG + Intronic
998802012 5:145878727-145878749 TCTGACAATTATGTGTTTTGAGG - Intergenic
1003709241 6:8570464-8570486 CATTACAGTTATGTCTTTTCTGG + Intergenic
1007475124 6:42114468-42114490 CCTTTCACTGATGTTTTTTCAGG + Intronic
1008713579 6:54260575-54260597 ACTTTCTATTTTGTGTTTTCAGG - Intronic
1008810304 6:55488937-55488959 GCTTCTAATTGTGTGTTTTCGGG + Intronic
1010931443 6:81808762-81808784 CCTTCCATTTATGATTCTTCCGG + Intergenic
1011205537 6:84891278-84891300 CCTCCCAATTATTTTTCTTCAGG - Intergenic
1011659750 6:89584065-89584087 CCTACTAAATATATGTTTTCAGG - Intronic
1011902413 6:92315224-92315246 GCTTACAAATATGTTTTTTCTGG + Intergenic
1012277747 6:97294441-97294463 CCTTCCAATTATGTTTTTTAGGG + Intergenic
1013019235 6:106195740-106195762 CCTTCCTTTTAGGTGATTTCAGG - Intronic
1014924710 6:127256706-127256728 TCTGACAATTATGTGTCTTCGGG - Intergenic
1015040325 6:128708607-128708629 CTTTTCAATTATATGCTTTCAGG + Intergenic
1016005860 6:139088883-139088905 TCTGACAATTATGTGTTTTGGGG + Intergenic
1016869362 6:148801453-148801475 GCTTCCAATTATGAATTTTCTGG + Intronic
1018712257 6:166505591-166505613 CCTTCTAATTTTGTGTTTGCCGG - Intronic
1019086026 6:169478062-169478084 CCCTCCAATCTTGTTTTTTCAGG - Intronic
1020513223 7:9085265-9085287 CCTTGCAATTATGTGACTTAAGG + Intergenic
1020577981 7:9958202-9958224 CTTTCCAATTATGTGTCTTTTGG + Intergenic
1020720109 7:11733501-11733523 TCTTCCATTTAGGTGTTTTGAGG + Intronic
1020833479 7:13120631-13120653 CCTTCCAACTATTTGGTTTTTGG + Intergenic
1021328244 7:19301123-19301145 CCTTCTAATTATGCATTTTTTGG - Intergenic
1021491836 7:21227373-21227395 CCTTCCAGTTTTGTGTTCTTGGG - Intergenic
1025723183 7:64034885-64034907 CCTTGCAATTTGGTGTCTTCTGG - Intronic
1025752322 7:64304506-64304528 CCTTGCAATTTGGTGTCTTCTGG - Intergenic
1026079183 7:67202109-67202131 CCTTCCAATTATGTGTTTTCTGG + Intronic
1026697640 7:72609847-72609869 CCTTCCAATTATGTGTTTTCTGG - Intronic
1028695350 7:93704334-93704356 CATTTCATTTATGTGTTTCCTGG + Intronic
1028810541 7:95081313-95081335 TCTTCCATTTATGTCATTTCAGG - Intronic
1033541768 7:142363261-142363283 CCTGCCATGTATTTGTTTTCTGG + Intergenic
1034581428 7:152046824-152046846 CCTTTTTATTATTTGTTTTCTGG + Intronic
1035405754 7:158596058-158596080 CCTTCCAATAAAGTCTTTTGTGG + Intergenic
1036076226 8:5504143-5504165 CTTCCCCAGTATGTGTTTTCTGG + Intergenic
1036084084 8:5594258-5594280 CTTTTCAATTATTTGTTTTGGGG + Intergenic
1037267310 8:17078672-17078694 CCTTCAAAGTATTTGTCTTCAGG - Intronic
1037398485 8:18468569-18468591 CCTGACAATTATGTGTCTTGGGG - Intergenic
1037406688 8:18549879-18549901 CCTTCCAACTCTGTATTTTTAGG - Intronic
1037625696 8:20605023-20605045 CCTTCCATTTATATAATTTCTGG + Intergenic
1038685193 8:29710210-29710232 TCTTCTAATTATGTGGTCTCAGG + Intergenic
1039660548 8:39458021-39458043 CCTTCCTATTATATGATTACTGG - Intergenic
1039662310 8:39480852-39480874 CCTTCCTATTAGGTGTATTGTGG - Intergenic
1041657234 8:60365886-60365908 CCTTTCCTTTATGTGTTTTGGGG - Intergenic
1041665764 8:60443415-60443437 CCTGATAATTATGTGTTTTGGGG + Intergenic
1041788355 8:61661030-61661052 CCTTCATATCTTGTGTTTTCAGG + Intronic
1041821882 8:62044950-62044972 CCTTCCAGTAATATGTTTTTGGG + Intergenic
1043043693 8:75294395-75294417 CCTTTCAGTTCTGTGCTTTCTGG - Intergenic
1043216464 8:77596229-77596251 CTTTCCAGTTTTGTCTTTTCAGG - Intergenic
1043803146 8:84637261-84637283 CCTTTCAAACCTGTGTTTTCAGG + Intronic
1045655819 8:104385431-104385453 CCTTCCAACAGTGTGTTCTCAGG - Intronic
1049184041 8:141239667-141239689 CTTGCCAAAGATGTGTTTTCAGG + Intronic
1050590924 9:7159792-7159814 TCTGCCAATTATGTGTCTTGGGG + Intergenic
1050604005 9:7282145-7282167 TCTGCCAATTATGTGTCTTGGGG + Intergenic
1050671868 9:8006832-8006854 TCTGCCAATTATGTGTCTTAGGG + Intergenic
1050678538 9:8083918-8083940 TCTGCCAATTATGTGTCTTGGGG + Intergenic
1051861202 9:21627147-21627169 CATGCAAATTCTGTGTTTTCAGG - Intergenic
1051949861 9:22618753-22618775 CCTTCCCATTAAGTGATATCTGG - Intergenic
1051997604 9:23237076-23237098 CCTTCCTATTATGTGATTAAAGG - Intergenic
1052004320 9:23328531-23328553 CTTTCCAGTTATTTGTTTTTAGG - Intergenic
1052241552 9:26279099-26279121 TCTTACAATTATGTGTCTTGTGG - Intergenic
1053560807 9:39192028-39192050 CCTTCCATCCCTGTGTTTTCTGG - Intronic
1053824909 9:42012278-42012300 CCTTCCATCCCTGTGTTTTCTGG - Intronic
1054136312 9:61426927-61426949 CCTTCCATCCCTGTGTTTTCTGG + Intergenic
1054605663 9:67175085-67175107 CCTTCCATCCCTGTGTTTTCTGG + Intergenic
1055132885 9:72795330-72795352 CCTGACAATTGTGTGTTTTGGGG - Intronic
1056136719 9:83636443-83636465 CATTGCAATTCAGTGTTTTCTGG - Intronic
1056384965 9:86089219-86089241 TCTGACAATTATGTGTCTTCAGG + Intronic
1058173911 9:101715832-101715854 CCTTCCAATTTTTGTTTTTCTGG - Intronic
1058266267 9:102902475-102902497 CCTTCCAATTATGTGCTATGTGG - Intergenic
1202630271 M:10812-10834 GATTCAAATTATGTGTTTTTTGG - Intergenic
1185835294 X:3340112-3340134 CTTTCCAAATATTTTTTTTCAGG - Intronic
1186354389 X:8774622-8774644 CCTGACAATTATGTGTCTTAGGG - Intergenic
1189590266 X:42503547-42503569 CTTTCCAATAAGGTGTTTCCAGG - Intergenic
1189618923 X:42815135-42815157 TCTGACAATTATGTGTCTTCGGG + Intergenic
1190039273 X:47056535-47056557 CCCTAGAATTAAGTGTTTTCTGG - Intronic
1191999104 X:67128751-67128773 CCCTCCAAATATGAGATTTCAGG + Intergenic
1192064116 X:67863194-67863216 TCTGGCAATTATGTGTTTTGGGG + Intergenic
1192686181 X:73307449-73307471 TCTGACAATTATGTGTTTTGGGG - Intergenic
1192744025 X:73920848-73920870 CTTTCCAGTTATGTGATTTTGGG + Intergenic
1193765596 X:85525733-85525755 CCATCTTATTATTTGTTTTCTGG + Intergenic
1194378290 X:93163222-93163244 CCTTGCAATTCTGAGTTTTGGGG - Intergenic
1194576174 X:95617378-95617400 TCTGACAATTATGTGTTTTGGGG + Intergenic
1195820708 X:108942869-108942891 TCTGACAATTATGTGTTTTGGGG + Intergenic
1195894111 X:109727838-109727860 CCATTAATTTATGTGTTTTCTGG - Intronic
1196872075 X:120121812-120121834 CCTGCCAAATAAGTTTTTTCAGG - Intergenic
1196941718 X:120783553-120783575 CCATCCAAATATGTCTTCTCAGG + Intergenic
1197088487 X:122508804-122508826 CTTTCCAATTATCTATTTTGCGG + Intergenic
1198784298 X:140271344-140271366 TCTGTCAATTATGTGTTTTGGGG + Intergenic
1198938693 X:141929073-141929095 CCTTTTTGTTATGTGTTTTCTGG + Intergenic
1199938000 X:152596260-152596282 CTTTCCAAGTATGTGTAGTCAGG - Intergenic
1201241387 Y:11960205-11960227 CTTTCCAAATATTTTTTTTCAGG + Intergenic