ID: 1026699706

View in Genome Browser
Species Human (GRCh38)
Location 7:72629508-72629530
Sequence TGTGCCACATAACCACAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 1, 2: 0, 3: 13, 4: 151}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026699706 Original CRISPR TGTGCCACATAACCACAAGA GGG Intronic
902569250 1:17336280-17336302 TTTGCCCCATCACCACAAGGGGG - Intronic
903970925 1:27118298-27118320 TGTGCCACCTACCCACAGGCAGG - Intronic
905508813 1:38502387-38502409 TGTGCCAGATAATGACAATATGG - Intergenic
909212053 1:72836480-72836502 TGTGCCACGCAACTGCAAGACGG + Intergenic
911352366 1:96769353-96769375 TGTGCCACATAACTACATTTTGG - Intronic
912218450 1:107643992-107644014 TGTGCCGCAGAACCCCCAGAGGG + Intronic
912947838 1:114099405-114099427 TGTGCTACATAAATACAAGGTGG - Intronic
914228245 1:145740278-145740300 TGTGACACATAATCACAGAAAGG + Exonic
915057281 1:153145344-153145366 TTTGGTAGATAACCACAAGAAGG + Intergenic
915652515 1:157326627-157326649 TGTACCAGGTAACCACAACATGG + Intergenic
916990047 1:170233274-170233296 TGTCCCAAATAACCAAGAGAGGG + Intergenic
919783663 1:201240963-201240985 TGTGCTCCATAAACTCAAGAAGG - Intergenic
920227411 1:204448703-204448725 AGTATCTCATAACCACAAGAAGG + Intronic
920665654 1:207960886-207960908 AGTGCCTCATAAACATAAGATGG + Intergenic
1064314683 10:14244318-14244340 GGTTCCACCTAACCACAAGGGGG - Intronic
1065154337 10:22854013-22854035 TATCCCACATCATCACAAGAAGG - Intergenic
1069167618 10:65182421-65182443 TGTGTGACATAACCTCATGAAGG - Intergenic
1071330893 10:84558955-84558977 TGTACCACATAAACAGAATAAGG - Intergenic
1073681487 10:105708869-105708891 TGTGACACATAGCCACAAAGTGG - Intergenic
1074100608 10:110351988-110352010 TGTGACAGATAACCACAAACTGG - Intergenic
1076112588 10:127872375-127872397 TTTGCCACATAATCTCGAGAGGG - Intergenic
1076631595 10:131855286-131855308 TGTGCCACACACACACAAGACGG + Intergenic
1078139762 11:8683361-8683383 TGTGCAACTTGACCACAAAAAGG - Intronic
1080925369 11:36750613-36750635 ATTGCCACAAAACCACATGAGGG + Intergenic
1081792680 11:45799463-45799485 TTTGCCTCATGGCCACAAGATGG + Intergenic
1088965035 11:114710960-114710982 TGTGCCACATTAACAAAATAAGG + Intergenic
1090040992 11:123291371-123291393 TGTGCCTCATGCCCACCAGAGGG + Intergenic
1093547304 12:20364116-20364138 TGTGCCAATTAACAACAATAGGG - Intergenic
1095763956 12:45873604-45873626 GGTTCCAGATCACCACAAGAAGG + Intronic
1096295419 12:50379886-50379908 TGTGCAAAATAAATACAAGAAGG + Intronic
1098409654 12:70167435-70167457 TGTACAACATAACCATAGGATGG + Intergenic
1102233628 12:111280520-111280542 TGTGCCCCATTACCACAAACTGG + Intronic
1105951209 13:25230908-25230930 TGTGTCACTTAACCACATGGAGG + Intergenic
1106910895 13:34462752-34462774 AGTGCCACAAAATCAAAAGAGGG + Intergenic
1108595940 13:51949352-51949374 TATGCCTCATAACCTCAAAAAGG + Intronic
1108747513 13:53409880-53409902 TGTGCCACATAACAACATTTTGG - Intergenic
1109002934 13:56829888-56829910 TGTCTCACATCACCCCAAGATGG + Intergenic
1112362149 13:98727931-98727953 TGTGCCTCAGAATCACCAGAGGG + Intronic
1114370959 14:22087594-22087616 TGTGGCACATACCCACATAATGG + Intergenic
1114792026 14:25670243-25670265 TCTCCTACATAACCACAATATGG + Intergenic
1115202263 14:30867651-30867673 TTTGCAACATACCTACAAGATGG - Intergenic
1116339000 14:43698639-43698661 TGTGGTAGATTACCACAAGATGG + Intergenic
1116937005 14:50750936-50750958 TGTGCAAAAGAAACACAAGAAGG - Intronic
1119145950 14:72314298-72314320 TTTCCCTCATAATCACAAGATGG + Intronic
1125927100 15:43571842-43571864 TATGGAGCATAACCACAAGAGGG + Intronic
1125940244 15:43671407-43671429 TATGGAGCATAACCACAAGAGGG + Intergenic
1126122749 15:45268192-45268214 TCTGCCCAATAACCACAGGAAGG + Exonic
1126159910 15:45601215-45601237 TGTGCTATATCATCACAAGAAGG - Intronic
1126477027 15:49076380-49076402 TGTACCACATCACCACATGTTGG + Intergenic
1126624296 15:50671430-50671452 TGTGCCACATAACAACACTGAGG + Intronic
1127764138 15:62168122-62168144 TGTGCCTAATAACCACATAAAGG + Intergenic
1130004866 15:80085795-80085817 TGTGCCACATAATGACATGTTGG + Intronic
1130357657 15:83148754-83148776 TGCTACACATAACCACATGAAGG + Intronic
1130755801 15:86761989-86762011 TGTGCCACATTAACTCAAGATGG - Intronic
1143833834 17:9674092-9674114 TGTGCCCCAGAACCACAGGAAGG - Intronic
1144427363 17:15156249-15156271 TATGCCATTTTACCACAAGAGGG - Intergenic
1149836109 17:59914434-59914456 TGTCCAACATTACCACCAGATGG + Intronic
1150125349 17:62631399-62631421 TGTGCCACCACACCACTAGAAGG + Intronic
1155581888 18:27318173-27318195 TATGCCACATAACAACATGTTGG - Intergenic
1156089569 18:33449647-33449669 TGTGACACATGACCACATAATGG - Intergenic
1156678456 18:39560264-39560286 TGTGCCACATGCCCACATCAGGG + Intergenic
1159050818 18:63419651-63419673 TATTTCACATAATCACAAGAAGG - Intronic
1160064881 18:75565456-75565478 TGTACCACATTACCACAAACTGG + Intergenic
1161452189 19:4352768-4352790 TGCCCCACATGACCACTAGAGGG - Intronic
928201975 2:29253282-29253304 TGTGCTACGTCACCACACGAGGG + Intronic
928937245 2:36691759-36691781 TATGCCAAATAAGCACATGAAGG - Intergenic
929358899 2:41059499-41059521 TGTGCCACATCACTTCAGGAGGG + Intergenic
929761799 2:44813391-44813413 TGTCCCAAATAGCCACAAGCAGG - Intergenic
931103848 2:59032595-59032617 TGTGTTACATAACCACAACCAGG + Intergenic
932475447 2:72003110-72003132 TCTGCCCCACAACCACAAGGAGG + Intergenic
935062529 2:99620865-99620887 TGTGTCACATGACAAGAAGAGGG - Intronic
937122973 2:119453495-119453517 GGTGCCACATTCACACAAGATGG - Intronic
938392078 2:130914666-130914688 TTGGCCACATATCCACAACAGGG + Intronic
939291521 2:140202078-140202100 TGTCTCCCATCACCACAAGATGG - Intergenic
940659808 2:156532336-156532358 TGAGACACATAATCACAAAAAGG - Intronic
941267083 2:163375663-163375685 TAGGCCACCTAACCACTAGATGG - Intergenic
942601517 2:177645102-177645124 TTTGCCTCATAGTCACAAGATGG - Intronic
943213448 2:184999359-184999381 TGTGACACATAGACACAAAATGG + Intergenic
947962286 2:234249201-234249223 TCTGTCTCATGACCACAAGATGG - Intergenic
948952286 2:241261758-241261780 TGTGCCACTTAACCACATGGGGG - Intronic
1168983176 20:2025052-2025074 AGTGACACTTAACCACAAAAGGG - Intergenic
1171391174 20:24802637-24802659 TCTGCCAAATGACCCCAAGAGGG + Intergenic
1172414085 20:34750097-34750119 GGCGCCACATAACCAGATGATGG - Exonic
1172462198 20:35127797-35127819 TGTGCCATATAACAACATGTTGG + Intronic
1173786788 20:45799617-45799639 TGTGACAGAGAACCACCAGAGGG - Intronic
1175850019 20:62085274-62085296 TGTGACAAATCACCACAAGCTGG - Intergenic
1177110611 21:17023200-17023222 TGTGTCACACAATAACAAGAAGG + Intergenic
1177211394 21:18076333-18076355 TTTGCCACTTCACAACAAGATGG - Intronic
949595154 3:5536167-5536189 TGTGCCACATAACAACATTTTGG + Intergenic
951602437 3:24391154-24391176 TGTGCATCATGGCCACAAGAAGG + Intronic
952426471 3:33179815-33179837 TGTGCCACATAACAACATTTTGG + Intronic
952525332 3:34204126-34204148 TGTGCAACATAAGCCCAGGAAGG - Intergenic
952991054 3:38831192-38831214 AGTGCCTCATAGACACAAGATGG + Intergenic
953050202 3:39334761-39334783 GGTGCCAAACAACCACAAGCTGG + Intergenic
953881990 3:46695416-46695438 AGTCCCACATAACCCCGAGAAGG - Intergenic
955252315 3:57296395-57296417 TCTGACACATCACCAGAAGATGG - Intronic
956506723 3:69948467-69948489 TTTTCCACAAAGCCACAAGAGGG - Intronic
956917950 3:73893440-73893462 TTTGCCTCATGATCACAAGATGG - Intergenic
957162583 3:76629371-76629393 TGATTCACATAATCACAAGATGG + Intronic
958698928 3:97563373-97563395 TGTCCCACAGAACTTCAAGAAGG + Intronic
962897630 3:139730463-139730485 TGTGCCACATCACAACATGATGG - Intergenic
964419821 3:156489846-156489868 TGTACCACACAACCTCAGGATGG + Intronic
967394857 3:188996752-188996774 TGAGCAACATGACTACAAGAGGG + Intronic
967440719 3:189505340-189505362 TGAGCCACATCACAAGAAGAAGG - Intergenic
971548242 4:27914683-27914705 TGTGGCACATATACACAAAATGG + Intergenic
973152320 4:46903339-46903361 TGTGCCACATAACAACATTTCGG + Intronic
974332616 4:60499568-60499590 TGTCCCTCATAACCTCCAGAAGG - Intergenic
977720568 4:100235732-100235754 TGTGCCAGGTAGCCACAACATGG - Intergenic
978593800 4:110355382-110355404 TCTGCCACATGTCCCCAAGAAGG - Intergenic
985126821 4:186702721-186702743 TATTCCACACACCCACAAGAGGG + Intronic
986238749 5:5937818-5937840 TATGCCACAGAACCCCCAGAAGG - Intergenic
987372201 5:17203525-17203547 TTTTCCAAATAACCACAAGGTGG - Intronic
990410971 5:55540902-55540924 TGTCCCTCATAATCAAAAGATGG - Intergenic
993986031 5:94598814-94598836 TGTGCCACATAACGACATTTTGG - Intronic
996308115 5:122074174-122074196 TGTCCCACAAAACAAAAAGATGG + Intronic
996568330 5:124905528-124905550 TCTGCCTCATAACAATAAGAGGG - Intergenic
998508609 5:142692552-142692574 TATGCAACATAACCCCAAGCAGG + Intronic
1004703746 6:18103637-18103659 TGAGCAAGATAACCAGAAGATGG - Intergenic
1005601176 6:27427782-27427804 GGTGTCACCTAACCAAAAGAGGG + Intergenic
1006625921 6:35397752-35397774 TCTGCCAGATAGCCATAAGACGG + Intronic
1007133215 6:39496247-39496269 TTTGCCACATGACCACAGGACGG + Intronic
1008123851 6:47647070-47647092 TCTGCCACTTGAGCACAAGATGG + Intergenic
1011328450 6:86176473-86176495 TGTGGCAGATGACCACTAGAAGG - Intergenic
1012319607 6:97826463-97826485 TATGCCACCAAACCTCAAGAAGG + Intergenic
1013461163 6:110376780-110376802 TGTGCCCCAGAAGCACCAGAAGG - Intergenic
1013957700 6:115859741-115859763 TGTGGCACATATACACATGATGG + Intergenic
1014039122 6:116803865-116803887 TGTTTCACATAAACACAAGATGG - Intronic
1014861891 6:126479072-126479094 TGTGCCACATAAACCGAAGGAGG - Intergenic
1014868793 6:126564610-126564632 TGTGCCACATAACCATACTTTGG + Intergenic
1015035745 6:128651997-128652019 TGTACCACATCACCTCAAGTTGG - Intergenic
1015208970 6:130674150-130674172 TTTGACAAATAACCACAAGTGGG - Intergenic
1020503138 7:8949068-8949090 TGTATCATATAACCATAAGATGG + Intergenic
1021102687 7:16601825-16601847 TGGGTCACAAAACCTCAAGAGGG + Intronic
1024482079 7:49874203-49874225 TGTGCCTCATAACCACATTTCGG + Intronic
1025307422 7:57874855-57874877 ACTGCCACAAAACCACCAGAAGG - Intergenic
1026077166 7:67182593-67182615 TGTGCCATATAACCACAAGAGGG - Intronic
1026699706 7:72629508-72629530 TGTGCCACATAACCACAAGAGGG + Intronic
1027134577 7:75615139-75615161 TTTGCCATACAACCACAAGAGGG + Intronic
1028044857 7:86105698-86105720 TGTGACACATAACCAAAAGGAGG - Intergenic
1028534158 7:91873172-91873194 TGACCCACAGAACCATAAGATGG - Exonic
1030865398 7:114696577-114696599 TTTTCCCCATAACCACAAAATGG + Intergenic
1033874164 7:145793909-145793931 ACAGCCACTTAACCACAAGAGGG - Intergenic
1035288835 7:157824315-157824337 GCTGCCAGAGAACCACAAGAGGG + Intronic
1036546653 8:9777238-9777260 TGTGCAAAATATCCTCAAGAAGG - Exonic
1037642897 8:20764233-20764255 TTTGCTAGATACCCACAAGAAGG - Intergenic
1038657352 8:29465944-29465966 TGTCTCACATCACCCCAAGATGG + Intergenic
1045689634 8:104746944-104746966 AGTGACACATGACTACAAGACGG - Intronic
1045913370 8:107436488-107436510 CGTTCCATATAAGCACAAGAGGG - Intronic
1046101797 8:109622873-109622895 TGTTCCACATTTCCAGAAGAAGG + Intronic
1047542931 8:125787907-125787929 TGGGCCACCTGACCACAAGAGGG - Intergenic
1050285086 9:4093071-4093093 TGTGCCACATAACAACATGTTGG - Intronic
1051781811 9:20696960-20696982 TGTGCCACATCATCACATGGTGG - Intronic
1056325316 9:85473605-85473627 TGTGCCACATAACAACATTTTGG + Intergenic
1057664272 9:97032042-97032064 TTTGACACATAACCTCAAGATGG - Exonic
1061525920 9:131162239-131162261 TGTGCCACATAACGACATTTTGG - Intronic
1061591367 9:131599771-131599793 TGTGACCTATGACCACAAGACGG - Intronic
1203363764 Un_KI270442v1:239682-239704 GGTTCCAGACAACCACAAGAAGG + Intergenic
1185767150 X:2734851-2734873 TGTGCCTCATTTCCACAAGAGGG - Intronic
1187971436 X:24662817-24662839 TGTCCCACATACCAAAAAGAAGG - Intronic
1189423342 X:40876215-40876237 TGTGCTTCATGATCACAAGATGG - Intergenic
1190790984 X:53699872-53699894 TGTGCCACAAAAATTCAAGAAGG - Intergenic
1193096994 X:77561225-77561247 TATCCCACATAAGCAAAAGATGG + Intronic
1195600633 X:106743714-106743736 TGGGTCAAATAAGCACAAGAAGG - Intronic
1195801979 X:108722899-108722921 TGTGCCACATAACCTGGTGAAGG - Intronic
1198956569 X:142137877-142137899 TGTACAAAATAACCACAAAAGGG + Intergenic
1201686580 Y:16711266-16711288 TATTACACATTACCACAAGATGG + Intergenic