ID: 1026704821

View in Genome Browser
Species Human (GRCh38)
Location 7:72681450-72681472
Sequence TGCCCAATGCAGACTGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 1, 2: 3, 3: 15, 4: 187}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026704811_1026704821 29 Left 1026704811 7:72681398-72681420 CCCCTGCTGTCCTGGGTGGTAAA 0: 1
1: 1
2: 0
3: 27
4: 202
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187
1026704816_1026704821 -9 Left 1026704816 7:72681436-72681458 CCTTCACCCAGAAGTGCCCAATG 0: 1
1: 1
2: 0
3: 26
4: 234
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187
1026704813_1026704821 27 Left 1026704813 7:72681400-72681422 CCTGCTGTCCTGGGTGGTAAAAG 0: 1
1: 1
2: 1
3: 14
4: 145
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187
1026704812_1026704821 28 Left 1026704812 7:72681399-72681421 CCCTGCTGTCCTGGGTGGTAAAA 0: 1
1: 1
2: 1
3: 23
4: 213
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187
1026704815_1026704821 -8 Left 1026704815 7:72681435-72681457 CCCTTCACCCAGAAGTGCCCAAT 0: 1
1: 1
2: 2
3: 14
4: 173
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187
1026704814_1026704821 19 Left 1026704814 7:72681408-72681430 CCTGGGTGGTAAAAGAAAGCACA 0: 2
1: 0
2: 1
3: 11
4: 181
Right 1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG 0: 1
1: 1
2: 3
3: 15
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026704821 Original CRISPR TGCCCAATGCAGACTGTGGG AGG Intronic
900467417 1:2832652-2832674 GGCCCAGTGCAGCCAGTGGGAGG + Intergenic
900651070 1:3730319-3730341 TGCCCACTCCTGGCTGTGGGAGG + Intronic
902096650 1:13951164-13951186 TGCCCAGTGCACAGTGTTGGGGG + Intergenic
902220317 1:14960482-14960504 TGAGCTCTGCAGACTGTGGGTGG + Intronic
902454560 1:16523229-16523251 TGCCCGCTGCAGACAGTGAGAGG + Intergenic
903147114 1:21381494-21381516 TTCCCAATGCAGACTTTGCAGGG + Intergenic
906311531 1:44757896-44757918 TTCCCTTTGCAGACTATGGGCGG + Exonic
906586655 1:46984460-46984482 AGATCAATGCAGAATGTGGGTGG + Intergenic
906809012 1:48807559-48807581 GGCCCAAAGCAGACTGGGGATGG - Intronic
907973377 1:59407075-59407097 TGCCCAAGGCAGACAGAGGGAGG - Intronic
910444605 1:87287462-87287484 TGCCCTATGCATACTGTGTTAGG - Intergenic
912223028 1:107699479-107699501 GGCACAGTGCAAACTGTGGGTGG + Intronic
912916376 1:113818843-113818865 CGCCACATGCAGACTGTAGGTGG - Intronic
915590598 1:156868232-156868254 TGCCCAATGCCAGCTGTGGTAGG + Exonic
916748612 1:167703764-167703786 TGCCTAATGCAGAATGGTGGAGG - Intronic
919394117 1:197023222-197023244 TGCACAATGCAAGCTGTTGGTGG - Intergenic
920010318 1:202862162-202862184 TGGCCAAAGCAGACTGAGGAGGG + Intergenic
921093881 1:211870107-211870129 TGCCCAACCCAGATTGTGGTGGG - Intergenic
1065800168 10:29344711-29344733 TCCTCCATGCAGCCTGTGGGTGG - Intergenic
1069719097 10:70538802-70538824 GGCCCAAGGCAGACGGGGGGTGG - Intronic
1070810757 10:79296621-79296643 TGCCCCATGTTGACCGTGGGGGG - Exonic
1071157335 10:82706207-82706229 TGCTAAATGCTGCCTGTGGGTGG + Intronic
1074208148 10:111302291-111302313 TGCTCAATGAAGCCTGGGGGTGG - Intergenic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1076229366 10:128807539-128807561 TCCCCAATGAATACTGAGGGTGG - Intergenic
1078085730 11:8232128-8232150 TGCACACTGTAGCCTGTGGGTGG - Intronic
1079080516 11:17410510-17410532 TGCCCCATGCAGACTGGGTGAGG - Exonic
1080151496 11:29057096-29057118 TGCACAATGCAAGCTGTTGGTGG - Intergenic
1080666131 11:34337976-34337998 TGCCCCATACATACTGTGAGAGG + Intronic
1083726093 11:64629139-64629161 TGCCCCATGCTGACTGCGAGGGG - Intronic
1084384653 11:68835689-68835711 TACCCCATGCAGACTGGGTGTGG - Intronic
1084660382 11:70543185-70543207 TTCACAACGCAGACTGTGTGTGG - Intronic
1084727665 11:70952529-70952551 TGCAAAATGCAGTCTCTGGGTGG + Intronic
1087074084 11:94112662-94112684 TTTCTACTGCAGACTGTGGGAGG + Exonic
1091691720 12:2601757-2601779 TGCCCAAGGGATGCTGTGGGAGG + Intronic
1092867548 12:12777230-12777252 TGCCCAGTGCAGACAGTAGATGG + Intronic
1093478795 12:19583620-19583642 TGCCTAGTGCAGACTCTGTGTGG - Intronic
1097444017 12:59646686-59646708 TGCACAATGCAAGCTGTTGGTGG - Intronic
1098692637 12:73507562-73507584 TGCCCAATGAAGACTGTGGCAGG + Intergenic
1101046532 12:100812072-100812094 TGCCTACTACAGTCTGTGGGGGG - Intronic
1101748106 12:107559415-107559437 TGCCCAGTGCAAACTGAGGCTGG + Intronic
1103816997 12:123666338-123666360 TGTCCAATGCTGAAAGTGGGAGG + Intergenic
1106714483 13:32373792-32373814 TCCCCACTGAGGACTGTGGGAGG + Intronic
1107330750 13:39296820-39296842 TGCACAATGCAAGCTGTAGGTGG - Intergenic
1107572565 13:41678355-41678377 TTTCCAATGCAGACTGTGTGTGG - Intronic
1107822048 13:44295068-44295090 TGTCCAAGGTAGACTGGGGGAGG - Intergenic
1108556716 13:51600680-51600702 TCCCCACTGCAGTCTGTGGATGG + Intronic
1110230786 13:73165242-73165264 TGCCCACTGAAGACTGTGGCAGG + Intergenic
1111083528 13:83343224-83343246 TGCACAATGCAAGCTGTTGGTGG - Intergenic
1117506872 14:56413202-56413224 GACCCAATGCAGATAGTGGGTGG + Intergenic
1119620906 14:76131277-76131299 TGGGGAATGCAGACTGTGGAAGG + Intergenic
1121166559 14:91807329-91807351 TGCACAATGCAAACTGTTGGTGG - Intronic
1122122291 14:99561013-99561035 TGCCCTGTGGAGACTGAGGGAGG - Intronic
1125599214 15:40906496-40906518 TGCCCACTGCAGACTCGGCGGGG - Intergenic
1126399782 15:48257294-48257316 TGCACAGTGCAAACTGTCGGTGG + Intronic
1128111927 15:65081927-65081949 TGACACATGCTGACTGTGGGTGG - Intergenic
1132712197 16:1274001-1274023 TGAGCAATGCAGACTGTGAGCGG - Intergenic
1134198469 16:12177794-12177816 TGCCAAATGCCTGCTGTGGGCGG + Intronic
1138246470 16:55470592-55470614 TGGGCAATGCAGTCTGAGGGTGG - Intronic
1142008141 16:87700094-87700116 TGTCCCATGAAGACTGTGAGGGG - Intronic
1143377393 17:6474753-6474775 TGGCCAGTGCTGACTGTAGGTGG - Intronic
1144449711 17:15366074-15366096 TTCTCAATGAAGACTGTGGTTGG - Intergenic
1146442147 17:32906724-32906746 TCCCCACTCCAGACTGAGGGTGG + Intergenic
1148835318 17:50462904-50462926 TGCCCAAGCCAGCTTGTGGGTGG + Intronic
1148847667 17:50538760-50538782 TGGCCCATGCACACTGAGGGTGG + Intronic
1149539571 17:57458826-57458848 TGCCCTGTGCAGGCCGTGGGAGG + Intronic
1153001627 18:460735-460757 TGCACATAGCAGACTGTTGGGGG - Intronic
1157319839 18:46625579-46625601 GGCCACATGCAGCCTGTGGGTGG + Intronic
1160724122 19:610136-610158 TGCCCGCTGCAGGCTGGGGGCGG + Intronic
1162063498 19:8110994-8111016 TCCCCCCTGCAGACTCTGGGTGG - Intronic
1162449247 19:10744552-10744574 TGTGGAATGCAGACTGTGGGTGG + Intronic
1162473360 19:10885616-10885638 TGCCTCTTGCAGACTGAGGGAGG + Intronic
1162918417 19:13886326-13886348 TGCCCAGATCAGCCTGTGGGAGG - Intronic
1163101481 19:15099834-15099856 GGCCACATGCAGCCTGTGGGTGG + Intergenic
1163403962 19:17111013-17111035 ACCCCAGTGCTGACTGTGGGTGG - Intronic
1164414039 19:28031402-28031424 TGCACAATGCAGGCTGTCAGTGG + Intergenic
1164916057 19:32053145-32053167 TTCCCAAGGGAGGCTGTGGGGGG + Intergenic
1166879143 19:45916476-45916498 TGGCCCATGGAGACTGTGGGTGG - Intergenic
1168496254 19:56854092-56854114 TGCCCAGTGCAAGCTGTAGGTGG - Intergenic
925737961 2:6980671-6980693 TGCCCAGTGCAAGCTGTTGGTGG + Intronic
927189492 2:20507457-20507479 TGGCCACTCCACACTGTGGGTGG - Intergenic
927861732 2:26564228-26564250 TTCCAACTGGAGACTGTGGGAGG - Intronic
929990758 2:46784205-46784227 TGAGCCATGCAGTCTGTGGGTGG + Intergenic
932960351 2:76406295-76406317 TGCCCAATGCTGGCAGAGGGTGG - Intergenic
933175342 2:79167386-79167408 TGCCCACTCCAAACAGTGGGAGG - Intergenic
934747653 2:96770076-96770098 GGCCCCATGCAGCCTATGGGCGG + Intronic
935663308 2:105488240-105488262 TGCCCAATCCACACTGAGGAAGG + Intergenic
936385118 2:112022416-112022438 TGCCCCATGCAGAGTATGGAAGG - Intronic
936924310 2:117721086-117721108 AGCAAAATTCAGACTGTGGGAGG + Intergenic
936967968 2:118146009-118146031 TGCTCAATGCAGCCTCTGGCAGG + Intergenic
937578392 2:123453612-123453634 TGCCCCATGCAGCCTGTGGGTGG - Intergenic
938079525 2:128362343-128362365 GGCCCTGTGCAGAGTGTGGGAGG + Intergenic
938831323 2:135052615-135052637 TGACCAAAGAAGACTGGGGGAGG - Intronic
940004050 2:148995207-148995229 GGCCCAGAGCAGACTGAGGGTGG - Intronic
940256918 2:151740944-151740966 TGCCCAATACCCACTGGGGGAGG - Intergenic
941239487 2:163018002-163018024 AGACCAATGCAGAAGGTGGGTGG - Intergenic
941543877 2:166820884-166820906 TGCTCAATACTGACTGTGAGGGG + Intergenic
944808917 2:203308959-203308981 TGCACAGTGCAAGCTGTGGGTGG - Intergenic
944876648 2:203969049-203969071 TCACCAAAGCACACTGTGGGAGG - Intergenic
945900706 2:215534356-215534378 TGCACAGTGCAAACTGTTGGTGG - Intergenic
946562446 2:220928063-220928085 TGCACAGTGCAAACTGTAGGTGG + Intergenic
948778019 2:240299876-240299898 TCCCCAAGGCAGGATGTGGGTGG + Intergenic
1168869028 20:1113364-1113386 TGCCCTATGAGGGCTGTGGGTGG - Intronic
1170011269 20:11726806-11726828 TTCTCAAAGGAGACTGTGGGGGG + Intergenic
1170299303 20:14865102-14865124 TGGGAAATGCAGCCTGTGGGAGG - Intronic
1170345758 20:15385105-15385127 TTCCAAATGCACACAGTGGGTGG + Intronic
1171118670 20:22549347-22549369 TGCACAGTGCAAGCTGTGGGTGG + Intergenic
1171307388 20:24117954-24117976 TCCCCAAAGCAGACGCTGGGAGG - Intergenic
1171490698 20:25515015-25515037 TGCCCAGTGGGGACTCTGGGTGG - Intronic
1174480870 20:50830480-50830502 TGCCCAATGCAGGGGGTTGGTGG + Intronic
1178315421 21:31562737-31562759 TGCTCACAGCTGACTGTGGGAGG + Intergenic
1179166300 21:38937815-38937837 TGCAAAATAGAGACTGTGGGAGG + Intergenic
1179494823 21:41764929-41764951 TGCCCAAAGCAGACAGGTGGTGG - Intronic
1180011362 21:45053674-45053696 TGGCCAGGGCAGACTGTGGAAGG - Intergenic
1183423640 22:37726037-37726059 TGCCCAATGCACACAGGGGTGGG - Exonic
1183473034 22:38019583-38019605 TGCCCAAGGCAGAGAGAGGGAGG + Intronic
1183819512 22:40334024-40334046 TGCCCAAATCAGAAGGTGGGTGG - Exonic
1184693637 22:46128359-46128381 GACCCAAAGCAGAGTGTGGGAGG + Intergenic
1185088672 22:48754107-48754129 TGGCCAGTTCAGACTGTGGATGG + Intronic
949984219 3:9526848-9526870 TGCCCCCTGCAGACTCTGGGAGG - Intronic
950485260 3:13269545-13269567 TGCCCAAGCCAGGTTGTGGGGGG + Intergenic
953488489 3:43326222-43326244 TGCTCAGAGCAGACTGTGGTGGG - Intronic
953570701 3:44069144-44069166 TACCTAAGGCAGACTGTGAGGGG + Intergenic
953848256 3:46445799-46445821 TGCCTGATGCACACTGTGGTTGG - Intronic
954451351 3:50573343-50573365 TGCCACCTGCAGACTTTGGGAGG + Intronic
957787506 3:84901357-84901379 TGCACAGTGCAAGCTGTGGGTGG - Intergenic
958563828 3:95781776-95781798 TGCCCAATGGGGACTCTGTGTGG - Intergenic
958887131 3:99739299-99739321 TGCACAATGCAAGCTGTCGGTGG + Intronic
959719400 3:109470069-109470091 TGCACAGTGCAAGCTGTGGGTGG - Intergenic
960494180 3:118355170-118355192 TGCACAGTGCAAACTGTCGGTGG - Intergenic
961342566 3:126238338-126238360 TGCACAATGCAAGCTGTGAGTGG + Intergenic
963878285 3:150500995-150501017 TGCACAATGCAAGCTGTTGGTGG + Intergenic
964258283 3:154804759-154804781 TGCCCAGTGCAAGCTGTTGGTGG + Intergenic
964653667 3:159042385-159042407 AGCCCAATGTAGACTGTAGGTGG + Intronic
969334400 4:6499074-6499096 TGCCCAAGGCAGATTGGGAGGGG + Intronic
970758097 4:19450705-19450727 TGCATAATGCAAACTGTCGGTGG + Intergenic
972054310 4:34780636-34780658 TGCACAATGCAAGCTGTTGGTGG + Intergenic
972270523 4:37506856-37506878 TGTCCAATGCTGAAAGTGGGTGG + Intronic
972895968 4:43620330-43620352 TGCACAATGCAAGCTGTTGGTGG + Intergenic
973063830 4:45763288-45763310 TGCACAATGCAAGCTGTTGGTGG + Intergenic
973530865 4:51835743-51835765 TGGCAAAGGAAGACTGTGGGTGG + Intergenic
976842250 4:89445344-89445366 TGCACAATGCAAACTGTCGATGG + Intergenic
979417357 4:120460391-120460413 AGACCAATGCAGAAGGTGGGTGG + Intergenic
979881897 4:125970600-125970622 TGCACAATGCAAGCTGTTGGTGG + Intergenic
980560040 4:134460602-134460624 TGCACAGTGCAAGCTGTGGGTGG - Intergenic
982236167 4:153253074-153253096 TACTCAATCCAGACTGTGGGTGG + Intronic
992924490 5:81567644-81567666 TGCACAGTGCAAGCTGTGGGTGG - Intronic
995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG + Intergenic
997246624 5:132355422-132355444 TCCCCAGTGGAGACTGTGTGGGG - Intergenic
998407597 5:141882894-141882916 TGCCCCATGCAAACTGAGGGTGG + Intergenic
999504372 5:152179878-152179900 TGCACAGTGCAAACTGTTGGTGG + Intergenic
1003690246 6:8346655-8346677 TGCCCAGTGCACGCTGTTGGTGG - Intergenic
1005921766 6:30407840-30407862 TGCACAGTGCAAACTGTTGGTGG - Intergenic
1007225988 6:40315009-40315031 TGCCCAGTACAGCCTGTTGGTGG - Intergenic
1007875595 6:45097498-45097520 AGCCCTATGCAGGCTGTGAGAGG + Intronic
1007916201 6:45564068-45564090 TGCCAAATCCAGATTGTGGAGGG + Intronic
1015599753 6:134900826-134900848 TGCAGAATGCAGAATGTAGGGGG + Intergenic
1018383235 6:163279931-163279953 TGCGCAGTGCAGGCTGAGGGTGG - Intronic
1019448089 7:1081746-1081768 TGCCCACTGCAGCCTGGGGGAGG + Intronic
1020088250 7:5323159-5323181 TGACCAATGCAGCCTTGGGGCGG + Intronic
1021963034 7:25891587-25891609 TGCCCACTGCCAACTTTGGGCGG - Intergenic
1023835201 7:44063845-44063867 TCCCCAAACCAGGCTGTGGGAGG + Intronic
1025206061 7:56993954-56993976 TGACCAATGCAGCCTTGGGGCGG - Intergenic
1025665878 7:63582985-63583007 TGACCAATGCAGCCTTGGGGCGG + Intergenic
1026072081 7:67130812-67130834 TGCCAAATGCAGACTGTGGGAGG - Intronic
1026613133 7:71878650-71878672 TGACCAATGTAGAGTGTGGGAGG + Intronic
1026704821 7:72681450-72681472 TGCCCAATGCAGACTGTGGGAGG + Intronic
1028309772 7:89316909-89316931 TGCAGAATCCAGAATGTGGGAGG - Intronic
1029548303 7:101222831-101222853 CGCCCAACTCAGGCTGTGGGAGG + Intronic
1030477172 7:110050399-110050421 TGCCCAATGCTGACTGTTGGAGG + Intergenic
1031471449 7:122173451-122173473 TGCCCCTTCCAAACTGTGGGAGG + Intergenic
1033167640 7:139054647-139054669 TGCCCAAATGAGACTGTGTGTGG + Intronic
1035038166 7:155908717-155908739 GGCCGAATGCAGAGGGTGGGAGG + Intergenic
1035174973 7:157044100-157044122 TGACCAAGGGAGGCTGTGGGTGG - Intergenic
1035233491 7:157481034-157481056 TGGCCAGTGCTGACTCTGGGAGG + Intergenic
1035766535 8:2110613-2110635 TGCCCAGTGTAGAGTGTGGTTGG + Intronic
1035822707 8:2611370-2611392 TCATCACTGCAGACTGTGGGAGG + Intergenic
1036754275 8:11462006-11462028 TGCCCAGTGCAGCCTGTAAGTGG + Intronic
1037588598 8:20294972-20294994 TCCCCCAAGCAGAGTGTGGGAGG + Intronic
1038110946 8:24496458-24496480 TGCACAGTGCAAGCTGTGGGTGG - Intronic
1039558706 8:38495912-38495934 CGCCCAATGCTGGCTCTGGGAGG + Intergenic
1041159723 8:55027222-55027244 AGCCCAATGCACACTGCTGGTGG + Intergenic
1041315307 8:56555323-56555345 TGCCCAAGAGAGACTGTAGGAGG + Intergenic
1041539832 8:58971175-58971197 TGCCAAAAGCAAACTGCGGGTGG + Intronic
1042071581 8:64941216-64941238 TGCACAGTGCAAACTGTTGGTGG + Intergenic
1044055968 8:87569966-87569988 TGCACAGTGCAAACTGTTGGTGG - Intronic
1045362769 8:101448541-101448563 TGCCCCCTCCAGACTGTGTGAGG - Intergenic
1046614063 8:116456534-116456556 CGCACAATGCAGACTTTTGGAGG - Intergenic
1048111611 8:131473870-131473892 TGCACAGTGCAAACTGTGTGTGG - Intergenic
1048329526 8:133462568-133462590 TGCTCAAGGCAGGCTTTGGGTGG - Intronic
1049287153 8:141782035-141782057 TGCCCAATAGAGCCAGTGGGGGG + Intergenic
1049318801 8:141984619-141984641 TGGCCAATGCAGTCTATGGATGG - Intergenic
1050053003 9:1622787-1622809 TGCACAGTGCATACTGTTGGTGG + Intergenic
1052343753 9:27387943-27387965 TGCCAAATGTTGCCTGTGGGGGG - Intronic
1056405644 9:86271822-86271844 TACACAATGCTGAATGTGGGTGG - Intronic
1057230363 9:93317926-93317948 TGCCCACAGCAGGCGGTGGGGGG - Exonic
1062181972 9:135195737-135195759 GGACCACTGCAGACAGTGGGTGG + Intergenic
1186686502 X:11930216-11930238 AGCCCAATGCAGGCTGTGATTGG - Intergenic
1186843918 X:13512258-13512280 TTCCCACAGCAGACTGTGAGGGG + Intergenic
1191734784 X:64377297-64377319 TGCACAGTGCAAGCTGTGGGTGG - Intronic
1191856080 X:65628115-65628137 TGCACAATGCAAGCTGTTGGTGG + Intronic
1192331088 X:70175750-70175772 AGCCCAAAGCAGAGTGGGGGTGG + Intergenic
1193895486 X:87110128-87110150 TGCCCCATGCAGCTTTTGGGTGG - Intergenic
1195997209 X:110743288-110743310 TGACCAATGCTGACTTTGGGTGG + Intronic
1198438510 X:136639654-136639676 TGCACAGTGCAGTCAGTGGGTGG + Intergenic
1199330257 X:146550746-146550768 AGCCCAGTGAAGACTGTTGGTGG + Intergenic
1200120876 X:153789986-153790008 TCCACAATGCACACTGTGGCAGG + Intronic