ID: 1026709247

View in Genome Browser
Species Human (GRCh38)
Location 7:72722909-72722931
Sequence GGTGTGGAAGACTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026709247_1026709256 28 Left 1026709247 7:72722909-72722931 CCTGCAGTGGAGTCTTCCACACC 0: 1
1: 1
2: 2
3: 4
4: 132
Right 1026709256 7:72722960-72722982 CCCCACCAGATGCCCTGCACTGG 0: 2
1: 1
2: 0
3: 26
4: 263
1026709247_1026709251 2 Left 1026709247 7:72722909-72722931 CCTGCAGTGGAGTCTTCCACACC 0: 1
1: 1
2: 2
3: 4
4: 132
Right 1026709251 7:72722934-72722956 GCGCTTCGACCTTTACCAGCAGG 0: 2
1: 1
2: 1
3: 0
4: 22

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026709247 Original CRISPR GGTGTGGAAGACTCCACTGC AGG (reversed) Intronic