ID: 1026709247

View in Genome Browser
Species Human (GRCh38)
Location 7:72722909-72722931
Sequence GGTGTGGAAGACTCCACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 1, 2: 2, 3: 4, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026709247_1026709251 2 Left 1026709247 7:72722909-72722931 CCTGCAGTGGAGTCTTCCACACC 0: 1
1: 1
2: 2
3: 4
4: 132
Right 1026709251 7:72722934-72722956 GCGCTTCGACCTTTACCAGCAGG 0: 2
1: 1
2: 1
3: 0
4: 22
1026709247_1026709256 28 Left 1026709247 7:72722909-72722931 CCTGCAGTGGAGTCTTCCACACC 0: 1
1: 1
2: 2
3: 4
4: 132
Right 1026709256 7:72722960-72722982 CCCCACCAGATGCCCTGCACTGG 0: 2
1: 1
2: 0
3: 26
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026709247 Original CRISPR GGTGTGGAAGACTCCACTGC AGG (reversed) Intronic
900628960 1:3623871-3623893 GGAGTGGAAGAAACCAATGCTGG - Intergenic
905481494 1:38265044-38265066 GATGTGGGAGACTCCTCTCCAGG + Intergenic
908246439 1:62230974-62230996 GGGCTGGATGACTCCACTGTGGG + Intergenic
912105273 1:106265227-106265249 GATGAGGAAGACTGCACAGCTGG + Intergenic
913263185 1:117019621-117019643 GGTAGGGACGAGTCCACTGCAGG - Intronic
913287579 1:117240971-117240993 GGAGTGGAAGACTCACCAGCAGG - Intergenic
916329571 1:163599625-163599647 GGGGAGGCTGACTCCACTGCAGG - Intergenic
922336984 1:224625705-224625727 GGTGTGGAGGAGGGCACTGCTGG + Intronic
1065869112 10:29941063-29941085 GGGATGGATGACTCCACAGCTGG - Intergenic
1072080380 10:92023911-92023933 GGTGTATAAGCCCCCACTGCCGG + Intronic
1072226943 10:93379235-93379257 GCAGTGGAAATCTCCACTGCAGG - Intronic
1072770953 10:98136890-98136912 GGTGTGGAATTTTCCACTGGTGG + Intronic
1077284590 11:1760005-1760027 GGCCTGGAAGACTCCCCTGGTGG + Intronic
1077294515 11:1819424-1819446 GCTGGGGAAGACTCCACTCTCGG + Intergenic
1077473804 11:2777068-2777090 GGTGCGGGAGAGTCCATTGCAGG - Intronic
1080601743 11:33827961-33827983 GGTCTGGAAGCCTGCAATGCAGG - Intergenic
1088095891 11:106101252-106101274 GGTGTGGTATACCCCTCTGCAGG + Intergenic
1089571571 11:119414756-119414778 GTTGTGGAAGACACCAGTGGGGG - Intergenic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1089925472 11:122252895-122252917 GGTGTGGAATTCTCCACTTGTGG - Intergenic
1091671623 12:2456345-2456367 GTTGTGGGAGACTCCCCTGTCGG - Intronic
1091710464 12:2736572-2736594 TATAAGGAAGACTCCACTGCAGG - Intergenic
1096543704 12:52322823-52322845 GATGAGGAGGACTCCACTGATGG + Intergenic
1103567728 12:121825269-121825291 GGTGTAGAAGCCCTCACTGCGGG - Exonic
1103860357 12:124007392-124007414 GCTCTGGAAGACACCCCTGCTGG + Intronic
1103970418 12:124667371-124667393 GGTGTGAATGAGTCCACTTCTGG - Intergenic
1104653691 12:130557251-130557273 GCTGTGGGGGGCTCCACTGCAGG - Intronic
1108300799 13:49073479-49073501 GGTGTGGAATTCTCCACTTGTGG - Intronic
1110862640 13:80359763-80359785 GGTGTAGATGTCTCCACGGCTGG - Intergenic
1113483264 13:110637040-110637062 GGTGTGGAAGGCCGCACGGCAGG - Intronic
1118246716 14:64117712-64117734 GGTGTGGAATTTTCCACTTCTGG + Intronic
1118448136 14:65870432-65870454 GGTCTGGAAGACCTCACTGGAGG + Intergenic
1120080829 14:80214260-80214282 GCTGCTGAAGTCTCCACTGCAGG - Intronic
1120358412 14:83463163-83463185 GGTGTGGAAGCCTGCAGAGCAGG - Intergenic
1122968686 14:105143764-105143786 GGTGGTGAAGTCGCCACTGCAGG - Intronic
1124668526 15:31616113-31616135 GTTGTGCAAGACCCCATTGCTGG - Intronic
1125742848 15:41979270-41979292 GTTGTGGCAGACTCCATTTCTGG - Intergenic
1125801809 15:42455401-42455423 GGTGTGGAATTTTCCACTGGTGG + Intronic
1130895989 15:88170918-88170940 GGGGTGGAAGGCACCACTGAGGG - Intronic
1132465232 16:74387-74409 GGTCTGACAGAGTCCACTGCAGG - Intronic
1137483828 16:48875104-48875126 GGTGGGAGAGACTCCAATGCAGG - Intergenic
1138552478 16:57755137-57755159 GGTGTGGAAGCAACCACTGGGGG - Exonic
1139964836 16:70739512-70739534 GCTGTGGAAGCTTCCAGTGCTGG + Intronic
1140069251 16:71634881-71634903 GTTGTGGAAGTTTCCAGTGCTGG + Intronic
1141033936 16:80612127-80612149 GGAGGGGAAGACGCCCCTGCCGG + Intronic
1141311798 16:82920600-82920622 GGTGAGGCTGTCTCCACTGCAGG + Intronic
1143820072 17:9553957-9553979 AGTGTAGAAAACTCCTCTGCTGG + Intronic
1151138950 17:71973499-71973521 GGTGTGGAAGTTTCCACTCGTGG - Intergenic
1153721229 18:7905560-7905582 GCTGCAGAAGACTCCACTTCAGG - Intronic
1155910639 18:31500637-31500659 TGTGTCACAGACTCCACTGCAGG - Intronic
1156389705 18:36638986-36639008 GGAATGGAAGACTCCAGTTCTGG - Intronic
1161354823 19:3813214-3813236 GTTCTGGAAGATTCCACAGCTGG + Intronic
1161498369 19:4599268-4599290 GGCATGGAAGACCCCACTGTGGG - Intergenic
1164536657 19:29090936-29090958 GGTGTGGAATGCTCAAGTGCTGG + Intergenic
1164900977 19:31922871-31922893 TGTGTGGAAGACTTGACTGGAGG - Intergenic
1168489350 19:56795313-56795335 CGTGAGGAAGACTCCGCGGCGGG - Intronic
928287674 2:30007753-30007775 CAGGTGGAAGACCCCACTGCAGG + Intergenic
933778548 2:85786503-85786525 GGGGTGGCAGGCTCCTCTGCAGG - Intronic
936076347 2:109404136-109404158 GGTGTGGCCGAGACCACTGCAGG + Intronic
937264893 2:120609170-120609192 AGTGTGGAGGCTTCCACTGCAGG + Intergenic
940686987 2:156864175-156864197 GATGAGGAATACTTCACTGCAGG + Intergenic
944386399 2:199169739-199169761 GGAGGGGTAGCCTCCACTGCCGG + Intergenic
947743382 2:232495257-232495279 CAAGTGGAAGACTCCACTGGAGG - Intergenic
1170211573 20:13850686-13850708 TCTGGGGAAGAATCCACTGCAGG - Intronic
1170990423 20:21296897-21296919 GGTGTGGAAGGGGACACTGCAGG - Intergenic
1173192962 20:40890190-40890212 GAGGAGGAAAACTCCACTGCTGG + Intergenic
1174458193 20:50664478-50664500 GGAGTGGAAATCTCCACTGAGGG + Intronic
1174696577 20:52565580-52565602 TGTGTGGGAGACTCTTCTGCAGG + Intergenic
1177330982 21:19662334-19662356 GGTGTGGAATTTTCCACTGGTGG - Intergenic
1179232638 21:39519141-39519163 GGTGTGGAAGATTCCAGTTGGGG + Intergenic
1181798113 22:25325093-25325115 GTTGTGTAAGACTACACTGCTGG - Intergenic
1184869040 22:47221935-47221957 GGTGTGGAAGGATCCTCTCCTGG + Intergenic
950399614 3:12760015-12760037 GGTATGGAAGACCCCTCTTCAGG - Intronic
951525675 3:23650648-23650670 GGTGTGGAACACTCCAGGGAGGG - Intergenic
960379017 3:116937110-116937132 GGTGTGGAATTTTCCACTGGTGG - Intronic
961243032 3:125428857-125428879 GGTGTTATAGACTCCACTTCTGG - Intergenic
961361730 3:126372487-126372509 GGGGTGGGAGCCTCCACTCCCGG - Intergenic
964620494 3:158716088-158716110 GGTGTCGCTGACTCCTCTGCAGG - Intronic
966690185 3:182733487-182733509 GGTAAGGAAGAATCGACTGCTGG - Intergenic
967602002 3:191401330-191401352 GGTGTTGAAGCCTCTACTTCTGG + Intergenic
968486103 4:863168-863190 GGAGTTGAAGACTTCAGTGCAGG + Intronic
968539584 4:1157803-1157825 GGAGTTGAAGACTTCAGTGCAGG - Intergenic
969631779 4:8343213-8343235 GGAGTTGAAGGCACCACTGCGGG + Intergenic
970518655 4:16861044-16861066 GGTATGGAGGACTTCTCTGCTGG + Intronic
972715476 4:41641742-41641764 GGTGTGGAATTCTCCACTTGTGG + Intronic
978340712 4:107719482-107719504 AGTTTGGAAGACTCCATTCCTGG - Intronic
980327306 4:131363817-131363839 GGTGTGAAAGACTCCACCAATGG + Intergenic
983058376 4:163126395-163126417 GGTGTTTAAGACTTCACTGGAGG + Intronic
985731035 5:1549061-1549083 GCTGCGGAAGACTCCAGGGCAGG - Intergenic
985969712 5:3365565-3365587 GCTGTGGGAGCCTGCACTGCGGG - Intergenic
987009963 5:13752456-13752478 GGTGTGGAATTTTCCACTGTGGG - Intronic
988638370 5:33012962-33012984 GGTGTGGAATTTTCCACTTCTGG - Intergenic
997597382 5:135116137-135116159 GCAGTGGAAACCTCCACTGCTGG + Intronic
998550625 5:143074430-143074452 GGGTTGGAACACTCCATTGCTGG + Intronic
999282043 5:150372379-150372401 GGAGTGCAAGACTCCCCTGTGGG - Intronic
1001570835 5:172729609-172729631 GGTGTGGAAGACTCCCACACTGG - Intergenic
1003392083 6:5723043-5723065 GTTGGGGAAGACTCCACAGATGG + Intronic
1003884524 6:10509632-10509654 GGTGTGGAATTTTCCACTGATGG + Intronic
1004367224 6:15022427-15022449 GGGGTGGAAGGCAGCACTGCAGG + Intergenic
1006092688 6:31637278-31637300 GGTGCGGAAGACTCCACTGTAGG - Exonic
1006187417 6:32189308-32189330 GGTGTGGAGGTCTCCACATCTGG + Intronic
1006235039 6:32622626-32622648 AGTGTGGAAGAGCCCCCTGCTGG - Intergenic
1007400761 6:41601021-41601043 GGTGTGGATGTCTCCAGAGCTGG - Exonic
1011219468 6:85038480-85038502 GGTGTGGAAAACCCATCTGCTGG - Intergenic
1013791086 6:113837339-113837361 CTTGTGGGAGACTCCACAGCTGG + Intergenic
1017118178 6:150998593-150998615 GGTGTGGAATTTTCCACTGGTGG - Intronic
1017629277 6:156380732-156380754 GGCCTGGAAGACTCCATTTCTGG - Intergenic
1017966459 6:159271097-159271119 GGTGGGGAAGACCCCACCCCAGG + Intronic
1021364577 7:19760925-19760947 GGTGTGGAAGAAAGCTCTGCGGG - Intronic
1023850804 7:44149301-44149323 GGTGTGGAAGACCCCTCTGCTGG + Intronic
1024282448 7:47730572-47730594 GGTCTCCAAGTCTCCACTGCAGG + Intronic
1026067678 7:67089422-67089444 GGTGCGGAAGACTCCACTGCAGG + Intronic
1026709247 7:72722909-72722931 GGTGTGGAAGACTCCACTGCAGG - Intronic
1026759284 7:73114357-73114379 GGTGTGGCTGAGTCCATTGCTGG + Intergenic
1027088124 7:75279116-75279138 GGTGTGGCTGAGTCCATTGCTGG - Intergenic
1029394231 7:100296272-100296294 GGTGTGGGTGAGTCCATTGCTGG - Intergenic
1039915933 8:41860313-41860335 GCTTTGGCAGATTCCACTGCTGG + Intronic
1040529924 8:48258299-48258321 AGTATGAAAGACTGCACTGCAGG - Intergenic
1040564497 8:48553586-48553608 GGTTTGGGAGAGTCCACAGCAGG + Intergenic
1042250916 8:66755439-66755461 GGTGTGGAATATTCCACTTGTGG + Intronic
1043422498 8:80113054-80113076 GGTGTGGAAGTCTCCATTTGTGG + Intronic
1044957716 8:97498715-97498737 GATGTGGAAGAGTCCACTGGAGG - Intergenic
1048238736 8:132719341-132719363 GGTGTGGAAGTTTCCACTTGTGG - Intronic
1048848437 8:138621269-138621291 GGTGTGGAAGGCCCAAGTGCAGG + Intronic
1049286866 8:141780621-141780643 GGAGTGGGAGACACCACTCCTGG + Intergenic
1049709197 8:144056097-144056119 GATGTGGACGGGTCCACTGCGGG - Intronic
1057696209 9:97324599-97324621 GGTGTGGAGGATTTCACAGCAGG + Intronic
1061168329 9:128937448-128937470 GGGCTGGAAGGCTCAACTGCTGG + Intronic
1062412757 9:136433254-136433276 GGAGTGGGAGACTCGTCTGCAGG - Exonic
1062512451 9:136914271-136914293 GGTGTGGGAGAAGGCACTGCTGG - Intronic
1186664507 X:11704080-11704102 GCTGTGGAACACCCCCCTGCAGG + Intergenic
1188399589 X:29728446-29728468 GGTGTTGTAGACCCCACTGGGGG + Intronic
1189222705 X:39385920-39385942 GGTGAGGATGACCCCACTCCTGG + Intergenic
1190259916 X:48791170-48791192 GGTGTGGAGGACACCAGAGCAGG - Exonic
1190784303 X:53629240-53629262 GGTGTGGAATTTTCCACTTCTGG - Intronic
1193871759 X:86806688-86806710 GGTGTGGATTACTCCACTTGTGG + Intronic
1195318965 X:103705818-103705840 GGTGTGGAAGAGCCCACTTCAGG - Intergenic
1197491736 X:127125308-127125330 GGAGTTGAAGACTGCAATGCTGG - Intergenic
1198328130 X:135595198-135595220 CGTGAGGAAGAGTCCCCTGCAGG + Intergenic
1198634644 X:138682501-138682523 GGTTTGGAAGACTGCACTGTAGG - Intronic