ID: 1026714346

View in Genome Browser
Species Human (GRCh38)
Location 7:72774190-72774212
Sequence CTAGTCTGACTGGCAGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 1, 2: 1, 3: 15, 4: 158}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026714346_1026714349 4 Left 1026714346 7:72774190-72774212 CCTGTTTCTGCCAGTCAGACTAG 0: 1
1: 1
2: 1
3: 15
4: 158
Right 1026714349 7:72774217-72774239 CTAAAGATGCACAAGGCATTAGG 0: 1
1: 1
2: 1
3: 18
4: 196
1026714346_1026714348 -3 Left 1026714346 7:72774190-72774212 CCTGTTTCTGCCAGTCAGACTAG 0: 1
1: 1
2: 1
3: 15
4: 158
Right 1026714348 7:72774210-72774232 TAGAAATCTAAAGATGCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026714346 Original CRISPR CTAGTCTGACTGGCAGAAAC AGG (reversed) Intronic
900382886 1:2393672-2393694 CTAGTCACACTGGCAGAGAGTGG + Intronic
906441526 1:45850138-45850160 CTATTCTGACTGGCATAAGATGG + Intronic
909868588 1:80707656-80707678 CTAGTTTGCCTGACAGAAACAGG - Intergenic
911687341 1:100792501-100792523 CAAGGCCAACTGGCAGAAACTGG + Intergenic
917869420 1:179229034-179229056 CTAGCCTGGCTGGCAGATCCCGG - Intronic
919356673 1:196533455-196533477 CTAGTCGTACTGGCATTAACTGG + Intronic
919747108 1:201015693-201015715 CTAGTCTGCCTGGCACACAGGGG + Intronic
922794010 1:228330051-228330073 CTAGTCTGACTGGTGGAACCAGG + Intronic
1063294643 10:4792475-4792497 GGTTTCTGACTGGCAGAAACAGG - Intronic
1063580455 10:7301677-7301699 CTATTCTGAAACGCAGAAACTGG + Intronic
1071675914 10:87655964-87655986 CAAGTACGACTGGCAGAAATAGG - Intergenic
1072605022 10:96973718-96973740 CTAATCTTAATAGCAGAAACAGG - Intronic
1073253206 10:102134237-102134259 GTAATCTGACACGCAGAAACTGG + Intronic
1074025467 10:109629242-109629264 CTAGTCTGACTGGCCCCAAAAGG + Intergenic
1076144524 10:128106755-128106777 CAAGTCTAACTGGCAGCAAGAGG - Exonic
1080145331 11:28976294-28976316 CTTCTCTCCCTGGCAGAAACAGG + Intergenic
1085748783 11:79140569-79140591 CTGCTCTGCCTGGCAGAAACAGG + Intronic
1086763612 11:90665889-90665911 CTATTCTGACTGGTATAAAATGG + Intergenic
1087986277 11:104684941-104684963 CTGGTATGACTGGCATAAGCTGG - Intergenic
1090058950 11:123447228-123447250 CCCGTCTGTCTGACAGAAACAGG - Intergenic
1093008107 12:14073102-14073124 CAAGTCTTACTGGCACATACTGG + Intergenic
1095964770 12:47859206-47859228 ATGGTGTGGCTGGCAGAAACAGG - Intronic
1098366907 12:69713018-69713040 CCAGGCTGACTGGCACAACCAGG + Intergenic
1099024042 12:77443364-77443386 TTAATCTGGCTGGCAGAAGCTGG + Intergenic
1100018317 12:90039320-90039342 CTACTGTGACTGGCAGTCACCGG - Intergenic
1106142560 13:27023474-27023496 CTACTCTGCCTGGCCAAAACTGG + Intergenic
1106669750 13:31891876-31891898 GTAGTCTAACAGGCAGAAGCAGG + Intergenic
1107309220 13:39058992-39059014 CTAGTCTGAGTGACAGAATGAGG - Intergenic
1109835545 13:67851805-67851827 CTAGAATGACTTGTAGAAACAGG - Intergenic
1111002445 13:82203866-82203888 CTAGTTTGACTGATAGAAATAGG - Intergenic
1111797599 13:92942856-92942878 CTAGTCTGACTGAGAAAAAATGG - Intergenic
1112149507 13:96741994-96742016 CTAATCTGGCTTGCAGAGACAGG - Intronic
1116691056 14:48106107-48106129 CTAATCTGAGTGGCAGTAATTGG + Intergenic
1116799294 14:49426567-49426589 CTAGTCTGTCTGGCAGCAGATGG + Intergenic
1118249199 14:64142544-64142566 CTAGTCTGGCTGGGAGAGTCAGG - Intronic
1119947295 14:78708358-78708380 CTTGACTGACTGGCTGAAATAGG + Intronic
1120965417 14:90163312-90163334 CTAGTTTTACTGGCAAAAATAGG - Intronic
1123429829 15:20204658-20204680 TGAGTCAGACTGGCAGAGACTGG + Intergenic
1124207058 15:27730181-27730203 CTAGACTGACTTACAGAATCAGG + Intergenic
1125300469 15:38249605-38249627 CTAGTCTGACTGTCAATCACTGG - Intergenic
1126272083 15:46831758-46831780 CCAGTCTGGCTGGTACAAACAGG - Intergenic
1127837087 15:62798644-62798666 CTAGTCTGTCTGGACAAAACTGG + Intronic
1128624421 15:69185014-69185036 CAACTCTGAGTGGCAAAAACTGG - Intronic
1133847091 16:9465392-9465414 CTAGTCTGACCAGTAGGAACAGG + Intergenic
1136854800 16:33646557-33646579 TGAGTCAGACTGGCAGAGACTGG - Intergenic
1137552676 16:49451250-49451272 CTAGTCTGGCTGGCCGGAACAGG + Intergenic
1138363115 16:56450147-56450169 GTACCCTGACTGGCATAAACTGG + Intronic
1141712469 16:85708048-85708070 CTAGTCTGGCTGGATGAGACAGG - Exonic
1203116375 16_KI270728v1_random:1495034-1495056 TGAGTCAGACTGGCAGAGACTGG - Intergenic
1142731421 17:1861018-1861040 CCCATCTGACTGGTAGAAACAGG + Intronic
1144587097 17:16493356-16493378 CTAGCCTGACAGGAAGAATCAGG - Intergenic
1145110951 17:20160874-20160896 TAAGTATGACTTGCAGAAACGGG - Intronic
1148611422 17:48967172-48967194 CTAGTCCCACTGCCAGGAACAGG + Exonic
1149216128 17:54357048-54357070 CCATTCTGAATGGGAGAAACTGG + Intergenic
1149676067 17:58463044-58463066 CTAGCCTGACTTGCAGAACATGG + Exonic
1151149864 17:72075942-72075964 CTAGACAGACTGGTAGAAAAGGG + Intergenic
1151277599 17:73047331-73047353 GTAGTCTGACTGACAGAAGGTGG - Intronic
1152753275 17:82076393-82076415 CTAGTCTGGTTGGTAGGAACAGG + Intergenic
1156622100 18:38864639-38864661 CTATTCTGAAAGGGAGAAACTGG - Intergenic
1158676585 18:59525264-59525286 CTATTCTGACTGGCATGAAATGG + Intronic
1159568333 18:70082575-70082597 CTAGTCAGACTGTGGGAAACTGG + Intronic
1160140772 18:76320267-76320289 CAAGTCAGACTGTTAGAAACAGG - Intergenic
1160709666 19:545175-545197 CCTGTCTGACTGGAAGAGACAGG + Intronic
927107563 2:19841086-19841108 GAAGTCTAACTGGGAGAAACTGG + Intergenic
929040237 2:37737427-37737449 CCAGTCTGGCTGGTAGAAGCAGG - Intronic
929627085 2:43420449-43420471 CTAGTATGAATGGCAGCAATAGG + Intronic
929868912 2:45741569-45741591 CCAATCTGATTGGTAGAAACTGG - Intronic
929869700 2:45748323-45748345 CTAGTAAGAGTGGCAGAAGCAGG + Intronic
931730171 2:65146303-65146325 CTAGTCAGGCTGGCAAGAACAGG + Intergenic
932325471 2:70857016-70857038 CTAGTCTGGCTGATGGAAACAGG - Intergenic
934163810 2:89276039-89276061 CTAGTGAGACGGGAAGAAACAGG - Intergenic
934203462 2:89906485-89906507 CTAGTGAGACGGGAAGAAACAGG + Intergenic
935481515 2:103595339-103595361 CCATTCTGAATGGGAGAAACTGG - Intergenic
936619036 2:114075936-114075958 CTAGTCTCAGAGGCACAAACAGG + Intergenic
936691456 2:114894253-114894275 GTAGTCTGACAGGCATAAATTGG - Intronic
938813973 2:134880939-134880961 AAAGTCTAACTTGCAGAAACAGG - Intronic
940411898 2:153374645-153374667 CTAGACTGACTGATAGATACTGG + Intergenic
940613082 2:156014879-156014901 CAGGTCTGACTGGAAGAAAGAGG + Intergenic
940764276 2:157772944-157772966 CCAGTCTGAGTAGTAGAAACGGG - Intronic
946577592 2:221092813-221092835 CTATTCTGACTGGCATAAGACGG + Intergenic
948678195 2:239611468-239611490 CTGGTCTGACCTGCAGAGACTGG - Intergenic
948955311 2:241285603-241285625 CTAGTGAAACTGGCATAAACAGG - Intronic
1169998169 20:11582878-11582900 CTGGACTCACTGGCAGACACAGG - Intergenic
1170738512 20:19031863-19031885 CTAGTCTGACTTGCAGAGTGTGG - Intergenic
1172573834 20:35991661-35991683 ACATTCTGACTGGCAGAAAGCGG + Intronic
1172768794 20:37364968-37364990 CTCCTCTGGCTGGGAGAAACTGG - Intronic
1175441490 20:58995550-58995572 CCAGGCTGGCTGGCAGGAACTGG - Exonic
1178875870 21:36413499-36413521 TTTATCTGACAGGCAGAAACTGG - Intronic
951824255 3:26850354-26850376 CCAGTCTGGCTGGTAGAAACAGG + Intergenic
954906287 3:54066019-54066041 GTAGTCTGTCTAGCAGCAACTGG + Intergenic
957656445 3:83083731-83083753 CTATTCTCACTAGCAAAAACTGG - Intergenic
958960623 3:100506142-100506164 CCAGTCTGGCTGGAAGGAACAGG - Intronic
961351109 3:126304362-126304384 CTAGACTGGCTGGTGGAAACAGG + Intergenic
962290981 3:134136145-134136167 CTACGCTGCCTGGCAAAAACTGG + Intronic
963080105 3:141383809-141383831 CTCGTCAAAGTGGCAGAAACAGG + Intronic
964108135 3:153060655-153060677 CTAGTCTGAGAGGCAGAAAAAGG - Intergenic
964682218 3:159354680-159354702 CAAATCTGACTGGCAGGAAAAGG + Intronic
965311779 3:167136914-167136936 CCATTCTGACTGGTGGAAACAGG - Intergenic
966211481 3:177457943-177457965 CTAGTCTGGCCAGCAGGAACAGG - Intergenic
968449001 4:666395-666417 CGAGCCTGCCTGACAGAAACTGG - Intronic
970137213 4:12938011-12938033 CTAGGCTGCCTGGCAGACAAAGG - Intergenic
972171522 4:36351215-36351237 TCAGGCTGACTGGCATAAACAGG - Intergenic
974487642 4:62525427-62525449 CAACTCTGAATGGGAGAAACTGG - Intergenic
975031325 4:69621453-69621475 CTAATCTGACTGACATAAAATGG - Intronic
975859195 4:78658244-78658266 CCTGTCTGAGTGACAGAAACAGG - Intergenic
977508531 4:97933055-97933077 CTATTCTGACTGGCATAAGATGG + Intronic
978509056 4:109495714-109495736 CTCGTGTGACTGGCAGATAAGGG + Intronic
979983967 4:127292635-127292657 CTAATCTGTCTGGTGGAAACAGG - Intergenic
980929004 4:139167498-139167520 TTATTCTGATTGGTAGAAACTGG + Intronic
981532639 4:145766780-145766802 CCAATCTGACTGGTGGAAACAGG - Intronic
983979181 4:173973295-173973317 CTACTTTGACTTGCTGAAACAGG - Intergenic
985491612 5:182985-183007 CTAGTCTGGCTGGTGGGAACGGG - Exonic
986060998 5:4191146-4191168 CCAGTCTGACTGTGAGACACAGG + Intergenic
987656972 5:20819600-20819622 CTAGTCTCCCTGCTAGAAACAGG - Intergenic
988766578 5:34384348-34384370 CTAGTCTCCCTGCTAGAAACAGG + Intergenic
989116377 5:37957447-37957469 CCAGTCTGACTGGTGGGAACAGG - Intergenic
990224411 5:53633092-53633114 CAAGTATAACTGGCAGAGACAGG - Intronic
990995024 5:61724357-61724379 TCAGTCTGGCTGGTAGAAACAGG + Intronic
993124026 5:83809793-83809815 CTAGTCTGGCTGGTGGGAACAGG + Intergenic
996722931 5:126647697-126647719 CTAGTTTGACTGAGAGAACCAGG - Intergenic
998500109 5:142625201-142625223 CTAGTGTAACTGGCAGGAAGTGG + Intronic
999217368 5:149946518-149946540 CTGATATGACAGGCAGAAACCGG - Intergenic
999354320 5:150910274-150910296 CCACTCTGTCTGGCAGGAACAGG - Intergenic
1001975943 5:175998409-175998431 CTAGTCCGGCTGTTAGAAACAGG - Intronic
1002241483 5:177845363-177845385 CTAGTCCGGCTGTTAGAAACAGG + Intergenic
1002540322 5:179902466-179902488 CTAGCCTGGCTGGCAGGAAAGGG + Intronic
1002938277 6:1693162-1693184 CCAGTCTGGCTGGTGGAAACAGG + Intronic
1003936773 6:10983016-10983038 CTAGGCTGACTGGCACAAGAGGG + Exonic
1003997087 6:11552824-11552846 ATAGTATGACTGGTAGAGACTGG + Intronic
1005083416 6:21980325-21980347 CTTTTCTGACTGGCAGTAACTGG - Intergenic
1005844307 6:29765683-29765705 CCAGTGTGACTGACACAAACAGG - Intergenic
1005856414 6:29866486-29866508 CCAGTGTGACTGACACAAACAGG - Intergenic
1005866024 6:29937785-29937807 CCATTCTGACTGGCATAAAATGG - Intergenic
1006067392 6:31471815-31471837 CCAGTGTGACTGACACAAACAGG + Intergenic
1007275341 6:40669184-40669206 CAAGTCTGTTTGGCAGAAGCTGG + Intergenic
1007285757 6:40746374-40746396 CTAGTCTGACAGATAGAACCTGG - Intergenic
1009465089 6:63959315-63959337 CTATTCTGACTGGCATGAAATGG - Intronic
1009703018 6:67208130-67208152 CTATTCTGACTGGCATAAGGTGG - Intergenic
1013472630 6:110478096-110478118 CTAGTCAGCCTGGCAGTCACTGG + Intergenic
1014655424 6:124097859-124097881 CTAGTCTGATTGGCAAAAGCTGG + Intronic
1016226216 6:141741796-141741818 CTATTCTGACTGGCATAAGATGG - Intergenic
1016384915 6:143521490-143521512 CTATACTGAGTGGCAGAACCAGG + Intergenic
1016990217 6:149923268-149923290 AAAGTCTGACTGGCTGAAGCAGG - Intergenic
1021475389 7:21055350-21055372 TTAGTGTGACAGGCAGAAGCAGG - Intergenic
1021482027 7:21128762-21128784 CTGGGCTGACTGGCAGCAGCAGG - Intergenic
1022342135 7:29478611-29478633 CTAGTTTAAGTGGCAGAACCAGG - Intronic
1022876684 7:34540374-34540396 CTATTCTGACTGGCATGAAGTGG + Intergenic
1022893298 7:34723142-34723164 CTAGGCTGCTTGGCAGAAAGGGG + Intronic
1024867342 7:53919188-53919210 TTAATCTGACTGGCAGAAGCTGG + Intergenic
1026064006 7:67053270-67053292 CTAGTCTGACTGGCAGAAGCAGG + Intronic
1026714346 7:72774190-72774212 CTAGTCTGACTGGCAGAAACAGG - Intronic
1030975171 7:116113133-116113155 ATAGTTTAACTGGCAGAAATAGG - Intronic
1031418808 7:121524689-121524711 CCAGTCTGACTGGCTGACAATGG - Intergenic
1034540784 7:151756630-151756652 TTGGTCTGTCTGGCAGGAACGGG - Intronic
1036035885 8:5018456-5018478 CTAGAGAGACTGGCAGAAACAGG + Intergenic
1038159449 8:25022892-25022914 CTAGTCTGCGCTGCAGAAACTGG + Intergenic
1038895190 8:31774882-31774904 CTATTCTGACTGGTATAAAATGG - Intronic
1043921530 8:85989194-85989216 CTAGCCTGAGTGACAGAGACAGG - Intronic
1044193979 8:89352899-89352921 CCATTCTGAATGGGAGAAACTGG + Intergenic
1046184601 8:110696492-110696514 CTAGCCTGACTGTCAGAAACAGG - Intergenic
1050092464 9:2028992-2029014 CTCTACTGACTGGCAGAGACAGG + Exonic
1052221336 9:26026899-26026921 CAAGCCTAAGTGGCAGAAACTGG + Intergenic
1055381305 9:75709898-75709920 CTGCTCTGACTGGTGGAAACAGG + Intergenic
1188079972 X:25826977-25826999 CTTCTCTGACTGGTGGAAACAGG - Intergenic
1189502277 X:41573965-41573987 CTAGTCTGACTGGTGGGAACAGG + Intronic
1190901497 X:54678393-54678415 CTATTCTGACTGGCATGAAATGG + Intergenic
1191225203 X:58035186-58035208 CCAGTCTGTCTGGCACAAGCAGG + Intergenic
1192620893 X:72679153-72679175 CTAGTCTGGCTAGTTGAAACAGG - Intronic
1192717383 X:73658876-73658898 CAAGTCTGACTGGCAGACCCTGG + Intronic
1194279981 X:91938707-91938729 CCAGTCTGACTAGTAGAAACAGG - Intronic
1195336799 X:103862881-103862903 CTACTCTGACTGACAGAGACTGG - Intergenic
1198672523 X:139096279-139096301 CTATTCTGTCTGGGGGAAACTGG + Intronic
1199059010 X:143330972-143330994 ATAGTATGTCTGGCAAAAACTGG + Intergenic
1200597458 Y:5162208-5162230 CCAGTCTGACTAGTAGAAACAGG - Intronic
1201561812 Y:15325179-15325201 TTAGTCTGGCTGGTGGAAACGGG - Intergenic
1202106490 Y:21373578-21373600 ATAGTAATACTGGCAGAAACTGG - Intergenic