ID: 1026723532

View in Genome Browser
Species Human (GRCh38)
Location 7:72853374-72853396
Sequence CAGGCGCCTGGGCCTGGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026723532_1026723538 14 Left 1026723532 7:72853374-72853396 CCTCAACCAGGCCCAGGCGCCTG No data
Right 1026723538 7:72853411-72853433 GAAGTTGCTACCCCTACCCCAGG No data
1026723532_1026723542 29 Left 1026723532 7:72853374-72853396 CCTCAACCAGGCCCAGGCGCCTG No data
Right 1026723542 7:72853426-72853448 ACCCCAGGTGAAAGTACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026723532 Original CRISPR CAGGCGCCTGGGCCTGGTTG AGG (reversed) Intergenic
No off target data available for this crispr