ID: 1026723672

View in Genome Browser
Species Human (GRCh38)
Location 7:72854417-72854439
Sequence CACAAGGACCTCATGACAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026723663_1026723672 11 Left 1026723663 7:72854383-72854405 CCCTCCTAGGCTGGGGGCTTCTC No data
Right 1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG No data
1026723664_1026723672 10 Left 1026723664 7:72854384-72854406 CCTCCTAGGCTGGGGGCTTCTCC No data
Right 1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG No data
1026723665_1026723672 7 Left 1026723665 7:72854387-72854409 CCTAGGCTGGGGGCTTCTCCTCC No data
Right 1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG No data
1026723658_1026723672 22 Left 1026723658 7:72854372-72854394 CCGTGGAAGGGCCCTCCTAGGCT No data
Right 1026723672 7:72854417-72854439 CACAAGGACCTCATGACAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026723672 Original CRISPR CACAAGGACCTCATGACAGC TGG Intergenic
No off target data available for this crispr