ID: 1026725858

View in Genome Browser
Species Human (GRCh38)
Location 7:72869434-72869456
Sequence TTGTCCTTCAAGAAGAGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026725848_1026725858 28 Left 1026725848 7:72869383-72869405 CCTCCCAAGTAGCTGGGATTACA 0: 48952
1: 142577
2: 242332
3: 522592
4: 386712
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data
1026725852_1026725858 1 Left 1026725852 7:72869410-72869432 CCCACCAGAACACCCAGCTCATT No data
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data
1026725851_1026725858 24 Left 1026725851 7:72869387-72869409 CCAAGTAGCTGGGATTACAGGTG 0: 27298
1: 77225
2: 165100
3: 221696
4: 302720
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data
1026725854_1026725858 -3 Left 1026725854 7:72869414-72869436 CCAGAACACCCAGCTCATTTTTG No data
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data
1026725853_1026725858 0 Left 1026725853 7:72869411-72869433 CCACCAGAACACCCAGCTCATTT No data
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data
1026725850_1026725858 25 Left 1026725850 7:72869386-72869408 CCCAAGTAGCTGGGATTACAGGT 0: 15366
1: 98640
2: 233329
3: 337639
4: 469862
Right 1026725858 7:72869434-72869456 TTGTCCTTCAAGAAGAGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026725858 Original CRISPR TTGTCCTTCAAGAAGAGACA GGG Intergenic
No off target data available for this crispr