ID: 1026729036

View in Genome Browser
Species Human (GRCh38)
Location 7:72895183-72895205
Sequence AGGAGCCATCTGGACAACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026729036_1026729039 -7 Left 1026729036 7:72895183-72895205 CCAGGGTTGTCCAGATGGCTCCT 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1026729039 7:72895199-72895221 GGCTCCTAAAGGCTCCCAACAGG 0: 1
1: 0
2: 0
3: 7
4: 78
1026729036_1026729040 -6 Left 1026729036 7:72895183-72895205 CCAGGGTTGTCCAGATGGCTCCT 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1026729040 7:72895200-72895222 GCTCCTAAAGGCTCCCAACAGGG No data
1026729036_1026729044 8 Left 1026729036 7:72895183-72895205 CCAGGGTTGTCCAGATGGCTCCT 0: 1
1: 0
2: 0
3: 20
4: 205
Right 1026729044 7:72895214-72895236 CCAACAGGGCATATCATGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026729036 Original CRISPR AGGAGCCATCTGGACAACCC TGG (reversed) Intronic
900544519 1:3221019-3221041 AGGAGTCATGTTTACAACCCAGG + Intronic
900613645 1:3554756-3554778 AGGGTCCACCTGGGCAACCCAGG + Intronic
900973093 1:6002215-6002237 AGGAGCCCTCTGGTCCTCCCTGG - Intronic
902554798 1:17240605-17240627 AGGAGGCAGCTGGGCAGCCCAGG - Intronic
905033782 1:34904498-34904520 AGGACCCATCTGGACCCTCCAGG + Exonic
905745136 1:40409630-40409652 AGGAGCCATGTGGGGAAACCAGG + Intronic
906503830 1:46362337-46362359 ATGAGCCATATGGAAAAACCAGG - Intronic
906806830 1:48787295-48787317 AGGGGTCATCTGGACATCCCTGG - Intronic
909078468 1:71081244-71081266 AGGCGCCATAAGGACAACCCAGG + Exonic
911783081 1:101908690-101908712 AGGGCCCATCTGGATAATCCAGG - Intronic
912559409 1:110539233-110539255 AGGAGCCACCTGAACAATGCTGG + Intergenic
916025704 1:160831695-160831717 TAAAGCCAACTGGACAACCCAGG - Intronic
916707387 1:167365516-167365538 AGGAGCAATCTCAACAGCCCAGG + Exonic
917224343 1:172765572-172765594 TGGAGGTGTCTGGACAACCCAGG - Intergenic
922260180 1:223933750-223933772 TGGGCCCATCTGGATAACCCAGG - Intergenic
922956297 1:229603927-229603949 AGCAGGCATCTGGACAGCACTGG - Intronic
922996436 1:229966038-229966060 TGGGGCCACTTGGACAACCCGGG - Intergenic
923404350 1:233645385-233645407 AGGGCCCATCTGGATAATCCAGG - Intronic
924341348 1:243036305-243036327 TGGGCCCATCTGGATAACCCAGG - Intergenic
1062830803 10:604134-604156 TGGACCCACCTGGACAATCCAGG + Intronic
1065768413 10:29053746-29053768 AGGAGGAATCTGGACAGGCCTGG - Intergenic
1066735124 10:38469125-38469147 TGGGCCCATCTGGATAACCCAGG + Intergenic
1069757149 10:70780275-70780297 AGGACCCTTCTGGCTAACCCTGG + Intronic
1072926689 10:99621987-99622009 AGGTGCCATGTGGACACCCTAGG + Intergenic
1074284843 10:112088447-112088469 AGGAGCCACCAGGACAGCCCTGG + Intergenic
1075160894 10:120023665-120023687 TGGAGCAACCCGGACAACCCAGG + Intergenic
1075512260 10:123082067-123082089 AAGAGCCAGCTGGGCAAGCCGGG - Intergenic
1076758098 10:132585651-132585673 AGGAGCAATGATGACAACCCTGG + Intronic
1076807461 10:132866249-132866271 AGGAGCCATCTGTACCACACAGG + Intronic
1077907757 11:6547062-6547084 AGGAGCCCTCTAGCCATCCCAGG - Exonic
1080414223 11:32054676-32054698 AGCAGCCCCCTGGACATCCCTGG + Intronic
1081478647 11:43462341-43462363 AGGACCCAACTGGATAATCCAGG - Intronic
1081860386 11:46330179-46330201 AGGAGCCATTTGGCCAAACTGGG + Intergenic
1087265081 11:96051744-96051766 AGGAGGCATCAGGAGAACCAGGG + Intronic
1091205332 11:133817116-133817138 AGAGCCCATCTGGACAGCCCAGG - Intergenic
1091380484 12:55015-55037 CTGAGCCATCTGGAGCACCCAGG - Intergenic
1091689859 12:2588470-2588492 GGGTGCAATCTGGACAGCCCAGG - Intronic
1094317110 12:29146815-29146837 AGGACTCATCTGGATAACCCAGG + Intergenic
1094515092 12:31121130-31121152 AGGACCCACCTGGAGGACCCTGG + Intergenic
1095383993 12:41628678-41628700 AGGAGCCATCTGCAAACCACAGG + Intergenic
1095801226 12:46271289-46271311 AGGAATCATCTAGACATCCCTGG - Intergenic
1095913395 12:47451547-47451569 AGGAGGCATCTGGAAAGCCATGG - Intergenic
1101308733 12:103556809-103556831 AGGACCCATCTGGTCAATCAAGG - Intergenic
1102045687 12:109828776-109828798 ATGAGCCAGCTGGGCATCCCTGG + Intronic
1103041758 12:117701634-117701656 AGGACCCAGCTGGACAATGCAGG - Intronic
1103976083 12:124703631-124703653 CTGACCCATCTGGATAACCCAGG - Intergenic
1104648066 12:130511096-130511118 AGAGCCCATCTGGATAACCCCGG - Intronic
1108833217 13:54505533-54505555 AGGACTCATCTGGACAAACCAGG - Intergenic
1112461747 13:99608536-99608558 AGGACCCTTCTGGACCAGCCTGG - Intronic
1115125094 14:29982734-29982756 AGGACCCATCTGGATAATCCAGG - Intronic
1116932477 14:50703750-50703772 TGGACCCACCTGGACAACCTAGG - Intergenic
1117991480 14:61438167-61438189 AGAAGCCGTCTGCACACCCCAGG + Intronic
1118349101 14:64960868-64960890 AGGAGCCATCTGGGCCCCACAGG - Intronic
1119946803 14:78703930-78703952 AGAAGCCATCTGGGCACTCCAGG + Intronic
1121007441 14:90499414-90499436 AGGTGCCCACTGGACATCCCAGG + Intergenic
1122417475 14:101557363-101557385 AGGATCCATCTGGGCCAGCCTGG + Intergenic
1202894884 14_GL000194v1_random:1314-1336 AGGAGGCAAATGGACACCCCAGG - Intergenic
1127299306 15:57637107-57637129 AGGGCCCAACTGGATAACCCAGG + Intronic
1128412272 15:67411371-67411393 AGGAGCCATGTGGACTATCTAGG - Intronic
1128567951 15:68713721-68713743 AGGATCCACCTGGATAATCCAGG + Intronic
1128911918 15:71523416-71523438 AGGGCCCACCTGGACAATCCAGG + Intronic
1130873632 15:87993112-87993134 AGGAGCCATATGGCCAAGTCAGG - Intronic
1131449050 15:92523976-92523998 AGGGTCCATCGGGACAACCCAGG - Intergenic
1132295212 15:100729506-100729528 AGGAGCCACCTGGATAATCCAGG - Intergenic
1132786560 16:1660093-1660115 AGGTGCCATCAGGGCAGCCCAGG - Intronic
1132873365 16:2125226-2125248 AGCAGCCATCTGCCCAGCCCGGG - Intronic
1132974882 16:2706245-2706267 AGGAGCCTTCGGAACAAGCCTGG + Intronic
1134234829 16:12457307-12457329 ACCTGCCAGCTGGACAACCCTGG - Intronic
1134600547 16:15530330-15530352 AGGGCCCACCTGGATAACCCAGG + Intronic
1134849283 16:17467922-17467944 AAGAGCCATCTGGAAAATCACGG + Intronic
1136288668 16:29258838-29258860 CTGAGCCACCAGGACAACCCAGG + Intergenic
1137590222 16:49688961-49688983 AGGAGCCACCTGCACTACCCTGG + Intronic
1138594273 16:58021387-58021409 AGGAGGCAGCAGGAGAACCCGGG - Exonic
1139970641 16:70772155-70772177 AGGAACCATCTGGACCTCCTGGG + Exonic
1141463876 16:84194561-84194583 CGGAGTCAGCTGGAGAACCCAGG + Exonic
1142094388 16:88231743-88231765 CTGAGCCACCGGGACAACCCCGG + Intergenic
1142661979 17:1436910-1436932 AGGAGACATCTTGAGAATCCGGG - Exonic
1143764810 17:9130513-9130535 AGGAGGCAGCTGGCCACCCCAGG - Intronic
1143979025 17:10852037-10852059 TGGAGCCACCAGGACAGCCCAGG + Intergenic
1144348173 17:14368625-14368647 AGGAGCCATCAGGAAAATCGAGG + Intergenic
1145279126 17:21455568-21455590 GGAAGCCATCTGGACACCCAAGG - Intergenic
1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG + Intergenic
1148346781 17:46908560-46908582 GGGAGCCATTAGGACCACCCTGG + Intergenic
1148472720 17:47905472-47905494 AGGCTCCATCTCCACAACCCAGG - Intronic
1151006919 17:70448673-70448695 AAGAGCCATCTGGGAGACCCGGG - Intergenic
1151193764 17:72417140-72417162 AGGGTCCATCTGGATAATCCAGG - Intergenic
1154312600 18:13278938-13278960 AGGAGGCACCTGGAGAATCCAGG + Intronic
1158618113 18:59006179-59006201 AGGGCCCACCTGGATAACCCAGG - Intergenic
1158938080 18:62383496-62383518 AGGAGCCATTTTGACATTCCTGG + Intronic
1160108767 18:76005404-76005426 AGGAGCCATGTGGAAAAACCTGG - Intergenic
1160471628 18:79140222-79140244 AGGAGCCAGCTGGTAAAGCCTGG + Intronic
1161133504 19:2605848-2605870 AGGGTCCACCTGGAGAACCCAGG + Intronic
1161495984 19:4585876-4585898 AGGAGCCATTTGGACATCTAGGG - Intergenic
1162322102 19:9976591-9976613 AGGGCCCACCTGGACAACCAGGG - Exonic
1162794378 19:13078933-13078955 AGGAGCCAGGTGGGCAGCCCAGG - Intronic
1163288735 19:16364979-16365001 AGGTGCCACCTGGACAAGACTGG - Intronic
1163325682 19:16601674-16601696 AGGAGTCCTCTGGACAAGCTGGG + Intronic
1164689675 19:30201260-30201282 AGGAAGCAGCTGGACAACACTGG + Intergenic
1166197928 19:41219106-41219128 AGGGGCCACCTGGACAATCAGGG - Intergenic
1166385255 19:42376896-42376918 AGGCCCCATCTGGGCAACCCTGG - Exonic
1167758578 19:51428664-51428686 TGGGCCCATCTGGATAACCCAGG - Intergenic
1202664736 1_KI270708v1_random:107753-107775 AGGTTCCATATGGACAACACAGG - Intergenic
926552808 2:14320312-14320334 AGAGACCATCTGGACAATCCTGG - Intergenic
926793838 2:16602571-16602593 AGGACCCATCTGGAGGACCTTGG - Intronic
927763079 2:25778232-25778254 AGGATCCATTTGGATAATCCAGG - Intronic
928138450 2:28706705-28706727 AGGACCCACCTGGATAATCCAGG - Intergenic
928723285 2:34144273-34144295 AGGACCCATTTGGATAATCCAGG - Intergenic
929951396 2:46412296-46412318 ATGAGCACCCTGGACAACCCAGG + Intergenic
931214269 2:60226742-60226764 AGCACCCATCTGGATAATCCAGG + Intergenic
931386120 2:61799042-61799064 AGGACCCACCTGGATAATCCAGG - Intergenic
932720075 2:74132231-74132253 AGGAGCCACCTGGACTAACCAGG - Intronic
936089770 2:109493990-109494012 AGGACCCATCCGGAAAACACAGG - Intronic
937021922 2:118665102-118665124 AGAAGCCACATGGACAACCAGGG + Intergenic
938109545 2:128554609-128554631 AGGGCCCACCTGGACAATCCAGG + Intergenic
940152203 2:150614982-150615004 AGGAGCCATCAGTAGAAGCCTGG + Intergenic
942579687 2:177404365-177404387 AGGAGCCATCTGAATAAGCACGG - Intronic
946431217 2:219628111-219628133 AGGAGTCCTCTGGCCGACCCCGG + Intronic
946893984 2:224304200-224304222 AGGACCCACTTGGATAACCCAGG - Intergenic
947010296 2:225558594-225558616 TGGACTCATCTGGACAATCCAGG + Intronic
948832155 2:240603384-240603406 AGGCCCCATCTGGAGAAACCAGG - Intronic
949084042 2:242133826-242133848 TGGGCCCATCTGGATAACCCAGG + Intergenic
1168881816 20:1212643-1212665 AGGGCCCACCTGGATAACCCAGG + Intergenic
1169862484 20:10167224-10167246 AGAAGCCATATGGACTCCCCAGG + Intergenic
1172102673 20:32494930-32494952 AGGAGCCATGTGAATAAGCCAGG - Intronic
1172372354 20:34404618-34404640 AGGAGCCAGCTTGACAAACATGG - Intronic
1173347595 20:42215192-42215214 AGGGGCCATCTCCCCAACCCAGG - Intronic
1174541984 20:51296864-51296886 GGGTGCCATCTGCACAGCCCTGG - Intergenic
1175545843 20:59777213-59777235 AGGGCCCATCTGGATAATCCTGG + Intronic
1175872657 20:62215820-62215842 AGGGGCCCTCTGGCCAACCCAGG + Exonic
1176182234 20:63755506-63755528 AGGACCCATCTGGACAATGCAGG + Intronic
1176280628 20:64306312-64306334 TGGGCCCATCTGGATAACCCAGG + Intergenic
1176293291 21:5057546-5057568 AGGGTCCATCTGCATAACCCAGG + Intergenic
1176870306 21:14078670-14078692 AGCTGCCATCTGTAAAACCCAGG + Intergenic
1177089091 21:16743642-16743664 AGGAACCATCTGGACATTCCAGG + Intergenic
1177422527 21:20878535-20878557 AGGAGCCAACTCTACAACCCAGG - Intergenic
1178311865 21:31536414-31536436 TGGTGCAATCTGGACCACCCCGG + Intronic
1179149429 21:38797184-38797206 AGGACCCAGCAGGATAACCCAGG + Intergenic
1179863969 21:44206104-44206126 AGGGTCCATCTGCATAACCCAGG - Intergenic
1179963357 21:44784713-44784735 ATGAGCCAGCTGGAGAACCTGGG + Intronic
1179988937 21:44935872-44935894 AGGAGCCTTCTGGCCACTCCTGG + Exonic
1181150809 22:20881939-20881961 TGGACCCAACTGGACAACCCAGG - Intronic
1181438665 22:22924638-22924660 TGGACCCACCTGGATAACCCAGG + Intergenic
1181632678 22:24159492-24159514 AGGAGCCACCTGGGAGACCCAGG - Intronic
1182028407 22:27138204-27138226 AGGAGCCATCTGGCCAGGCAGGG + Intergenic
950088549 3:10278574-10278596 AGGAGGCATCTACACAGCCCAGG - Intronic
955105734 3:55895969-55895991 AGCAGCCGCCTGGAGAACCCAGG + Intronic
957926962 3:86826809-86826831 TGGAGAAATCTTGACAACCCAGG + Intergenic
964099491 3:152971726-152971748 TGAAGACATCTGGACAAGCCAGG - Intergenic
964212642 3:154245526-154245548 AGGAGCCATCTGGCCATCTGAGG - Intronic
965779248 3:172266789-172266811 AGGTCCCATCTGGATAACTCAGG + Intronic
967965386 3:194956487-194956509 AGGAGCCAGCTGGAGCACCTGGG - Intergenic
968258367 3:197298644-197298666 AGGAGCCAACTGCACCTCCCAGG + Intronic
968472776 4:789678-789700 GGCAGCCATCTGGACAGGCCCGG - Intronic
968864239 4:3197610-3197632 AGGAGCAAACAGGAGAACCCAGG - Intronic
969213903 4:5708352-5708374 AGGAGCCACCTGGGGATCCCGGG + Exonic
970362374 4:15322716-15322738 AGGACCCACCTGGATAATCCAGG + Intergenic
971327682 4:25657377-25657399 GGGAGCAATCAGGACATCCCAGG + Intronic
972118634 4:35671460-35671482 TGGACCCATCTGGATAATCCAGG + Intergenic
972335062 4:38100474-38100496 AGGGCCCATCTGGATAATCCAGG + Intronic
972733177 4:41814948-41814970 AGGGCCCATCTGGATAATCCAGG + Intergenic
975496454 4:75040873-75040895 ATGAGCCATGTGGATAACCGAGG - Intronic
975904825 4:79196779-79196801 AGGACCCACCTAGATAACCCAGG - Intergenic
976997559 4:91454469-91454491 AGGACCCACCTGGATAATCCAGG + Intronic
978466540 4:109015015-109015037 TAGAGCCATCTGGCCAAACCAGG + Intronic
979261479 4:118652065-118652087 TGGGCCCATCTGGATAACCCAGG + Intergenic
979760996 4:124404861-124404883 AGGGCCCATCTGGATAATCCAGG - Intergenic
980083160 4:128365461-128365483 AGGACCCACCTGGATAATCCAGG + Intergenic
982770280 4:159390736-159390758 CTGAGCCAGCAGGACAACCCGGG + Intergenic
983150358 4:164271270-164271292 TGGGCCCATCTGGATAACCCAGG - Intronic
985289867 4:188376566-188376588 AGGGTCCATCTGAACAATCCAGG + Intergenic
986024570 5:3838564-3838586 AGGACCCACCTGGATAATCCAGG - Intergenic
992284823 5:75223919-75223941 AGCAGCCATCCGCACAATCCAGG + Intronic
993382394 5:87222609-87222631 TGGATCCATCTGGATAACCTAGG - Intergenic
994210410 5:97082256-97082278 AGTAACCAGCTGGACAACCTAGG - Intergenic
995587115 5:113659693-113659715 AGGACCCACCCAGACAACCCAGG - Intergenic
997206903 5:132055565-132055587 AGGAACCATATGGCCACCCCAGG + Intergenic
998287753 5:140879942-140879964 AGGGCCCATCTGGATAATCCAGG + Intronic
1005520736 6:26598429-26598451 AGGAGCCATCTGGGCGAGCAGGG - Exonic
1005715121 6:28539823-28539845 AGGATCAATTTGAACAACCCAGG - Intergenic
1007282871 6:40725276-40725298 AGGAGCCCTCTTGACAGGCCTGG + Intergenic
1007752998 6:44081341-44081363 GGGGGACACCTGGACAACCCAGG - Intergenic
1013039270 6:106417732-106417754 AGGAGCCAGCTGGCCACTCCAGG + Intergenic
1015118910 6:129680069-129680091 AGGACCCAACTGGATAATCCAGG + Intronic
1016278685 6:142386768-142386790 TGGAGCCATCTGGGCAGCTCGGG + Intronic
1016415100 6:143823848-143823870 TGGAGCCATCTGGGCCACACAGG - Exonic
1018324384 6:162649416-162649438 CAGAGCCATCTCGACAAACCAGG + Intronic
1018817356 6:167343426-167343448 AGGAGCCCTCTTAACAACACAGG - Intronic
1022340680 7:29464679-29464701 AGGAGTCACCTGGCCAACCTGGG - Intronic
1026729036 7:72895183-72895205 AGGAGCCATCTGGACAACCCTGG - Intronic
1030513268 7:110511395-110511417 CAGAGCCATCTGGATAATCCAGG + Intergenic
1031079843 7:117247640-117247662 AGGGTCCATCTGGATAATCCAGG + Intergenic
1032415228 7:131730389-131730411 AGGAGGCTTCTTGACAGCCCTGG + Intergenic
1032492197 7:132331951-132331973 ATAAGGCATCTGGACAACCTTGG + Intronic
1033109578 7:138562470-138562492 AGAAGCCATCTGGAGAATACAGG - Intronic
1034849798 7:154483030-154483052 TGGAGCCATCTGGAGGACCATGG + Intronic
1034885605 7:154796051-154796073 TGGAGCTCTCTGGGCAACCCTGG - Intronic
1035945770 8:3960027-3960049 AGGAGCCTTCTGGGCATCTCAGG + Intronic
1037373312 8:18203100-18203122 TGGAGCCAGCTGGACATCCTGGG - Intronic
1040279501 8:46031792-46031814 AGCTGCCATCTGTAAAACCCAGG + Intergenic
1041516130 8:58700682-58700704 TGAAGACATCTGAACAACCCTGG + Intergenic
1042553153 8:70012161-70012183 AGGGACCATCTGTACTACCCAGG + Intergenic
1042989963 8:74628225-74628247 ACGAAGCATCTGGAGAACCCAGG + Intronic
1043293706 8:78637660-78637682 AGGGACCATGTGGACAACCCAGG - Intergenic
1045677706 8:104626601-104626623 AGGGCCCATCTGGATAATCCAGG + Intronic
1047609303 8:126505305-126505327 AGGAGCCTTCTAGAACACCCAGG - Intergenic
1050570257 9:6931038-6931060 AGGATTCATCAGGAGAACCCTGG + Intronic
1051111147 9:13638197-13638219 AGGGTCCACCTGGATAACCCAGG + Intergenic
1052877102 9:33575463-33575485 ACGTGGCATCTGAACAACCCTGG + Intergenic
1054919223 9:70525186-70525208 TGGACCCATCTGGAGAATCCAGG + Intergenic
1055443499 9:76359561-76359583 AGGAGCCATGAGGTCACCCCAGG + Exonic
1057926415 9:99154807-99154829 GGGGGCCATCTGGATAATCCAGG + Intergenic
1060565908 9:124591465-124591487 ATGAGCCATCTGGGCAACAGGGG + Intronic
1061226085 9:129281751-129281773 AGAAGCCCTCTGGACAGGCCTGG - Intergenic
1061363618 9:130158823-130158845 AGAAGCCCTCTGGACAGGCCTGG - Intergenic
1061676324 9:132217970-132217992 AGGAGCGATATGGACCACACCGG - Intronic
1185837644 X:3360250-3360272 AGGGTGCACCTGGACAACCCAGG + Intergenic
1186142460 X:6590389-6590411 AGGAGCCATTTGAAGAACCTGGG - Intergenic
1186988325 X:15040301-15040323 AGGGCCCATCTGGATAATCCAGG - Intergenic
1187934455 X:24322126-24322148 AGGGGCTATCTGGACATCCTAGG + Intergenic
1191243569 X:58208267-58208289 TAGAGACACCTGGACAACCCAGG + Intergenic
1192176178 X:68886929-68886951 AGGAGCTAACTGGCCAAGCCTGG - Intergenic
1195031152 X:100928924-100928946 AGGAGCTATCCTGAGAACCCTGG - Intronic
1199677906 X:150203199-150203221 AGGACCCATCTGGAGACCTCTGG - Intergenic
1201238181 Y:11931485-11931507 AGGGTGCACCTGGACAACCCAGG - Intergenic
1202383566 Y:24300526-24300548 TGGGCCCATCTGGATAACCCAGG + Intergenic
1202487217 Y:25369594-25369616 TGGGCCCATCTGGATAACCCAGG - Intergenic