ID: 1026735542

View in Genome Browser
Species Human (GRCh38)
Location 7:72946378-72946400
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 3, 1: 0, 2: 2, 3: 33, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026735527_1026735542 21 Left 1026735527 7:72946334-72946356 CCTACCCCGGATCTCTGGCTTCA 0: 3
1: 0
2: 2
3: 22
4: 198
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269
1026735537_1026735542 -6 Left 1026735537 7:72946361-72946383 CCAGGGGGCAGTGGCAGCCCTGG 0: 3
1: 0
2: 8
3: 109
4: 893
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269
1026735530_1026735542 15 Left 1026735530 7:72946340-72946362 CCGGATCTCTGGCTTCAGCCGCC 0: 3
1: 0
2: 0
3: 23
4: 296
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269
1026735528_1026735542 17 Left 1026735528 7:72946338-72946360 CCCCGGATCTCTGGCTTCAGCCG 0: 3
1: 0
2: 0
3: 7
4: 102
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269
1026735536_1026735542 -3 Left 1026735536 7:72946358-72946380 CCGCCAGGGGGCAGTGGCAGCCC 0: 3
1: 0
2: 6
3: 49
4: 453
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269
1026735529_1026735542 16 Left 1026735529 7:72946339-72946361 CCCGGATCTCTGGCTTCAGCCGC 0: 3
1: 0
2: 4
3: 35
4: 332
Right 1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 33
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900389117 1:2426482-2426504 TCCTGGGGGCCTTTCCCTCCGGG + Intronic
900391113 1:2434361-2434383 CCGTGGGGCCCCTTCTCTCCCGG + Intronic
900395936 1:2453265-2453287 CCCTGGGGCCCTTCCCCGTGTGG + Intronic
900484376 1:2914496-2914518 CATTGGGGCCCTTTTCCTTCAGG + Intergenic
900624200 1:3600738-3600760 GCCTGGGCCCCTGTCCCTTTGGG - Intronic
900793111 1:4692335-4692357 TCATGCAGCCCTTTCCCTTCTGG + Intronic
902170310 1:14604831-14604853 CCCTGGGGCTCTTTGCTTGCAGG - Intronic
902573780 1:17363765-17363787 CCCTGGCGTCCTCTCCCTCCTGG + Exonic
902869855 1:19307410-19307432 CCCGGGGTCCCTCTCCCTGCAGG - Exonic
903352882 1:22728757-22728779 TCCAGAGGCCTTTTCCCTTCGGG - Intronic
903678958 1:25084184-25084206 CCCTGGGGCCCTGGGCCTTGAGG - Intergenic
904008799 1:27378351-27378373 CCCTGGGGCCCTTTCCCCCTTGG + Intergenic
904745310 1:32707131-32707153 TCCTGGGCCCCCTTGCCTTCTGG + Intergenic
905614093 1:39381956-39381978 CTCAGTGGCCCTTTCCCATCGGG - Exonic
907498559 1:54861546-54861568 CCCTGGGGGCCTCTCACATCCGG + Intronic
907792030 1:57676254-57676276 CACCAGGGCCCTTTCCATTCAGG + Intronic
908547387 1:65175263-65175285 CCCTGTTCCCGTTTCCCTTCCGG + Intronic
910504672 1:87936206-87936228 CCCTGTTGCCCTATCCCTCCAGG - Intergenic
911091678 1:94022312-94022334 CCCTCGGCACCTTTCCCTTTTGG + Intronic
914386184 1:147172287-147172309 CCCTGGAGCCCTCTCCCTCCTGG + Intronic
915563390 1:156700586-156700608 TCTTGGGGCCCTCTCCCTTCAGG + Exonic
915612637 1:157006836-157006858 CACTGGGGCCCTTCATCTTCTGG - Intronic
915889059 1:159754043-159754065 TCCTGGCACCCTTTCCCTTCTGG + Intergenic
915971257 1:160356781-160356803 CCCTGGGGCCCCTTTCCCTTGGG + Intronic
920374638 1:205501291-205501313 CCCTGGGGCCCATCCCCTGTGGG - Intergenic
920500204 1:206480740-206480762 CCATGGGCCCCTTCCCCTGCAGG - Intronic
921503302 1:215933791-215933813 TCCTGGGGTCCTTTGCCTTCAGG + Intronic
922798379 1:228352822-228352844 GGCTGGGGCCCTTCCCCTTGTGG + Intronic
922924293 1:229334979-229335001 TCCTGGAGGCCTTTCCCCTCTGG - Intronic
923715533 1:236421957-236421979 CCATGTGGCCCTCTCCCTCCTGG - Intronic
924359211 1:243218357-243218379 CACTGGGGCCCTTGCCCCTCTGG - Intronic
1062919234 10:1266566-1266588 CCCTGGGCCGCCTTCCCATCTGG + Intronic
1063099189 10:2934861-2934883 CTCCTGGGGCCTTTCCCTTCAGG + Intergenic
1063158325 10:3399960-3399982 CCCTGGGGCTATTTCCTTCCTGG + Intergenic
1063247174 10:4233621-4233643 CCCTGGCTTCCCTTCCCTTCAGG - Intergenic
1063459954 10:6208917-6208939 TACTGGGGCCCGTTCCCTGCAGG - Intronic
1065544685 10:26807651-26807673 ATTTGGGGCTCTTTCCCTTCAGG + Intronic
1066434518 10:35384758-35384780 CCCTGGGACCCTTTCAGTTTAGG + Intronic
1067878634 10:50025174-50025196 CCCTGGGGCCATCTGCCTGCAGG + Intergenic
1067893092 10:50152762-50152784 CCCTGGGGCCATCTGCCTGCAGG - Intergenic
1069558141 10:69411219-69411241 CCATGGGTCCCCTTCCCTTGGGG - Intronic
1069903718 10:71720208-71720230 CCCTGGGCCCCATTCCTTCCAGG + Intronic
1070596011 10:77833846-77833868 CCTGGGGCCCCTCTCCCTTCTGG - Intronic
1072280102 10:93858134-93858156 CCCTGGAGGCATTTGCCTTCTGG + Intergenic
1072693126 10:97584499-97584521 CCAGGGGGCCCTGTTCCTTCTGG - Exonic
1074085147 10:110204148-110204170 TCCTGGGTACCTTTCCCTTTTGG - Intergenic
1074191981 10:111146124-111146146 GCCTGGGACCCTTTCCCCTTTGG + Intergenic
1074497897 10:113996085-113996107 TCCTGCGGCCCTTCCCCTTGAGG + Intergenic
1076296047 10:129385684-129385706 CCCTGTGGCTTTTTCCTTTCTGG - Intergenic
1077273146 11:1691181-1691203 CCCTGGGGCCCTTCCCTCCCCGG + Intergenic
1077464239 11:2726040-2726062 GCCTGGGGCCCCTTCTCTGCCGG - Intronic
1081567588 11:44269649-44269671 CCCAGGGCCCCTTTTCCTCCAGG + Intronic
1083197940 11:61102235-61102257 CCCTGCAGCCCTGTCCCTCCAGG + Intergenic
1083409630 11:62483151-62483173 CCCTTGGGCCCTGGGCCTTCGGG - Intronic
1083668283 11:64286790-64286812 GCCTGGGGCCCTTGCCCTTCTGG + Exonic
1083724989 11:64623291-64623313 CCCTGGGTGCCCTCCCCTTCTGG - Intronic
1083764351 11:64834963-64834985 CCCTGAGCCCCTTCCCATTCAGG - Exonic
1084174758 11:67417460-67417482 CCCAGGGGCCCTCTTCCTCCAGG - Exonic
1084219416 11:67668067-67668089 CCCTGGGCCTCCCTCCCTTCTGG + Intronic
1084497370 11:69512908-69512930 GCCGGGGCCCCTTTGCCTTCAGG + Intergenic
1084887195 11:72218518-72218540 GCTTGGAGCCCTTTCCCCTCAGG + Intronic
1087762115 11:102111679-102111701 CCCTGGGCCCCTTTCCTTTGCGG + Intronic
1088613870 11:111603209-111603231 CCATGGGGCCCTTCCTCGTCGGG - Intronic
1089789112 11:120929717-120929739 GCATGGGGCCCTTCCTCTTCTGG + Intronic
1090188288 11:124752105-124752127 TCCCGGGGCCCTTTCTCTGCGGG - Exonic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1091344411 11:134843355-134843377 TCCTGAGGCCATTTCTCTTCTGG + Intergenic
1091660044 12:2376657-2376679 CACAGGAGCCCTTTCCCTTGGGG + Intronic
1091800455 12:3321512-3321534 CCCTGGGGCCTTCACCCTGCAGG + Intergenic
1092106276 12:5923674-5923696 TACTGGGGACTTTTCCCTTCAGG - Intronic
1094473175 12:30822429-30822451 CGCTGGTGCCCTTTCCCTGTGGG + Intergenic
1097150923 12:56979343-56979365 GCATTGGGTCCTTTCCCTTCTGG + Intergenic
1097245450 12:57605197-57605219 CCCAGGGACCCTTGCCCATCCGG + Intronic
1098626593 12:72678552-72678574 CCCTGGAACGTTTTCCCTTCTGG + Intergenic
1100287925 12:93184932-93184954 CCCTGGGGCCATGTTGCTTCAGG - Intergenic
1101233753 12:102767497-102767519 CTCTGGGCCCCATTCCCATCTGG - Intergenic
1102453393 12:113057180-113057202 CCCCGGGGCCCTCGCCCTGCCGG - Intronic
1102581180 12:113889108-113889130 CCCTCTGGTCCTTTCCCTACAGG + Intronic
1105284977 13:18996197-18996219 CCCTCTGGCCCTCTGCCTTCTGG - Intergenic
1106032183 13:26013329-26013351 CCCTGCCTCCCTTTCCCTTCCGG + Intronic
1110221963 13:73083447-73083469 CCATAGGGCCCTTTTCCTACAGG - Intergenic
1111497517 13:89071425-89071447 CCCTGGGGCTCTTTTCCTGAGGG - Intergenic
1113832332 13:113305996-113306018 ACCTGGTGCCCTGTCCCTTTCGG - Intronic
1116164963 14:41323540-41323562 CCCTGGGGCGCTGACCCTCCAGG - Intergenic
1116817867 14:49599818-49599840 GCCTGCGGCCCTCTCCCCTCCGG + Intronic
1117690078 14:58297868-58297890 GCCTGCGGCCCCTTCACTTCCGG + Intronic
1118762755 14:68890554-68890576 GTCTGGGGCCCTTTCCCCACAGG - Intronic
1119806438 14:77485308-77485330 CCCTGGGGGCCTTTCTCCTCTGG - Intronic
1122113388 14:99516286-99516308 CCCCGAGACCCGTTCCCTTCAGG - Exonic
1122900637 14:104780906-104780928 CCCTGGGGCCCCTGCCCAGCTGG - Intronic
1122912830 14:104841677-104841699 CCCTGGGGCCCTCACACCTCTGG + Intergenic
1124345339 15:28918370-28918392 TCCTGTGTCCCTCTCCCTTCAGG - Intronic
1127221816 15:56887734-56887756 CCCTGGTGACCTTTCCCCTCAGG + Intronic
1130561473 15:84962755-84962777 CACTCTGCCCCTTTCCCTTCTGG - Intergenic
1132087052 15:98917058-98917080 CCCTGGTCCCTGTTCCCTTCAGG - Intronic
1132306606 15:100819448-100819470 GCCTGGGGGCCTTTCACCTCGGG - Intergenic
1132664430 16:1075072-1075094 CCCGGTGGCCCTGTCCCTTGTGG - Intergenic
1132951332 16:2564040-2564062 CCCTGGGTCTCGTTCCCGTCAGG - Intronic
1132963018 16:2636130-2636152 CCCTGGGTCTCGTTCCCGTCAGG + Intergenic
1133275218 16:4634214-4634236 CCCTGGGCCCCTTTCAGGTCTGG + Intronic
1134042978 16:11082296-11082318 CCCTAGGGCCCTGGCCCTGCAGG - Intronic
1134231393 16:12433052-12433074 CCCTGGGGCTCCTTCCACTCAGG - Intronic
1135542867 16:23345817-23345839 CTCTGAGAGCCTTTCCCTTCTGG - Intronic
1136009085 16:27350838-27350860 CCTTGCCTCCCTTTCCCTTCTGG - Intronic
1136912924 16:34159325-34159347 CCCGGGTGCCCTTGCCCTTGCGG + Intergenic
1137802750 16:51276057-51276079 CCATGGGTACCTTTGCCTTCTGG + Intergenic
1138434151 16:56987932-56987954 CCCTGGAGCCCTTTTCACTCTGG - Intergenic
1139631649 16:68235272-68235294 CCCTCGACCCCTTTCGCTTCCGG + Intronic
1139957403 16:70699712-70699734 CCCAGGTGCCCTTCCCCTGCAGG - Intronic
1140509886 16:75499245-75499267 CCCTTGGGCCCTGCCCCTCCAGG + Intergenic
1140515678 16:75539454-75539476 CCCTTGGGCCCTGCCCCTCCAGG + Exonic
1140963200 16:79937401-79937423 CCCTGGGGTCATTTACCTACTGG + Intergenic
1142031509 16:87840757-87840779 CCCTGCGGCCCCTTTCCTCCAGG - Intronic
1144709801 17:17394115-17394137 CCCTGTGGCCCTTGCCCAACGGG - Intergenic
1146473227 17:33140872-33140894 CCCTGGGGCACATTCCATCCGGG + Intronic
1147185002 17:38708421-38708443 CCTGGGGGCCCTTACCCTCCTGG - Intronic
1148028719 17:44605556-44605578 CCCTGGCTACCTTTCCCCTCTGG - Intergenic
1149442972 17:56690733-56690755 CCCTGGGCCCCTATTCCTTGTGG - Intergenic
1149658138 17:58320794-58320816 TCCTGGTCCCCTTTGCCTTCTGG - Intronic
1149864268 17:60141785-60141807 CCCTGGGGAGCTTTCCCTCACGG + Intergenic
1151457067 17:74232598-74232620 CCATGGGGCCCTTCCCCACCAGG - Intronic
1151499729 17:74481164-74481186 CCCTGGGGACCTATCCCTTCAGG - Intronic
1151559942 17:74864674-74864696 CCCGGGGGCCCTGTGCCTTTGGG - Intronic
1152253564 17:79224451-79224473 CCCTGGGGCCATTTCCTTTAGGG + Intronic
1152375914 17:79918970-79918992 CCCTAGCCCCCTTTCCCTGCAGG - Intergenic
1153920165 18:9782041-9782063 CCCTGGTGCCCATTCCCATGTGG + Intronic
1155237609 18:23836689-23836711 CCCTGGGGCCCTTTCTCTCGAGG + Intronic
1155237932 18:23840199-23840221 GCCTGATGCCCTTTCCCTCCTGG + Intronic
1155455259 18:26005110-26005132 TCCTGGCGCCCTTTCCCTCGTGG - Intergenic
1157213665 18:45764354-45764376 CCTTGAGGCCCGCTCCCTTCTGG - Intergenic
1157629006 18:49078547-49078569 CCTTCCGGCTCTTTCCCTTCTGG + Intronic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1162087996 19:8260045-8260067 CCCTGGGCCCCTTCCCTCTCTGG - Intronic
1162331834 19:10034688-10034710 CCCTGATGCCCTTTGCCTTTGGG + Intergenic
1163215195 19:15871333-15871355 CTCTGAGTCCCTTTCTCTTCTGG - Intergenic
1163492521 19:17625154-17625176 CATTGGGGCCCCTTCCCATCTGG - Intronic
1163809017 19:19418843-19418865 CCCCAGGGCTCTTTTCCTTCCGG - Intronic
1165147052 19:33737556-33737578 CCGTGGGGACAATTCCCTTCTGG - Intronic
1166128811 19:40733244-40733266 CCCTGGGGCCCCTACCCCTGAGG + Exonic
1166685199 19:44792526-44792548 CCCTGTGGCGCCTTCCCCTCTGG + Intronic
1167278760 19:48554242-48554264 CCCTGGGGCCCACTTCCTTCGGG + Intronic
1167484105 19:49750581-49750603 CTCTGGGTCTCTTTTCCTTCAGG - Intronic
1167689684 19:50977618-50977640 TCCTGGGGAACTTTCCCTTGCGG - Exonic
1168107532 19:54173744-54173766 CCCAGGGGCCCCTTCCGTTTTGG + Exonic
1168276392 19:55280797-55280819 CTCTGGGGCACTTTGCTTTCCGG - Intergenic
927156254 2:20223500-20223522 GCCAGGGGCGCTTCCCCTTCCGG - Intronic
927481482 2:23457441-23457463 TTCTGGGGCCCTTCCCCTCCAGG + Intronic
927504568 2:23604572-23604594 CCTTGGGGGGCTTTTCCTTCTGG + Intronic
928094283 2:28394225-28394247 TCCTGGGACCCTATTCCTTCAGG + Intronic
928169585 2:28994856-28994878 CCATGGTGCCCCTTACCTTCGGG - Exonic
929487764 2:42370132-42370154 CCCTGGGGACCATCCCCTTACGG - Intronic
931356135 2:61538697-61538719 CCCTGCGGCCCTCTCCCTCCCGG + Intergenic
932397830 2:71460270-71460292 CCCCGGCCCCCTTTCCCCTCTGG - Intronic
932659867 2:73642572-73642594 GCCTGGGTTCCTTGCCCTTCTGG + Intergenic
932666436 2:73702248-73702270 GCCTGGGTTCCTTGCCCTTCTGG + Intergenic
934038552 2:88108846-88108868 CACTGGCTCCCTTTCCCTCCTGG - Intronic
934103403 2:88674518-88674540 ACCTGGGGCCCTTCCCCTACTGG + Intergenic
934132725 2:88965020-88965042 CCCTGAGTGCCTTTCCCTCCTGG - Intergenic
934148101 2:89116118-89116140 CCCTGAGTGCCTTTCCCCTCTGG - Intergenic
934221185 2:90084491-90084513 CCCTGAGTGCCTTTCCCCTCTGG + Intergenic
934674516 2:96240166-96240188 GCCTTGGTCCCTTTCCCCTCAGG + Intergenic
937031303 2:118743333-118743355 CCAAGGGGCACATTCCCTTCAGG + Intergenic
937992242 2:127671091-127671113 CCCTTGGCCCCTTTCCCACCTGG + Intronic
937993860 2:127679044-127679066 CCCTGGAGCTCTTTCCCTCCGGG - Intronic
938593434 2:132762574-132762596 CAGTGGGGCCTTTCCCCTTCAGG + Intronic
938697962 2:133851739-133851761 TCCTGGGGCCCTTATCTTTCAGG - Intergenic
946199608 2:218064232-218064254 CCCTGGGGCCCTCTGCTTCCAGG - Intronic
947232654 2:227903534-227903556 CCCTTTGGCCTTTTCCCCTCTGG - Intronic
947975711 2:234364165-234364187 CCCTGGGGCCTGTTCCCTGATGG - Intergenic
948076479 2:235168717-235168739 CCCAGCGGCCCTTCCCCATCTGG - Intergenic
1168854911 20:1001843-1001865 CCCTGCTACCCTCTCCCTTCTGG + Intronic
1168936576 20:1670958-1670980 CTCTGGAGACCTTTGCCTTCAGG - Intergenic
1169771693 20:9208161-9208183 CCCTGGGACCCTTCCTCTTAAGG - Intronic
1171206205 20:23283248-23283270 CCCTGGTGGCCTCTCCCTCCTGG + Intergenic
1171444015 20:25190786-25190808 CCCTGGCTCCCTTTCCACTCAGG - Intergenic
1172668235 20:36615374-36615396 CCCTGGACCCCTTTCTCCTCAGG - Exonic
1172978105 20:38921223-38921245 CCCTGGGGAGCTTTCCCTGTAGG + Exonic
1173947172 20:46960850-46960872 CTGTGGGGCCCCTTCCCTGCTGG + Intronic
1173993026 20:47317497-47317519 AGCTGCGGCCCTTTCCCTTGAGG - Intronic
1175156112 20:56972762-56972784 CCCCGGGCCCCTCTGCCTTCTGG - Intergenic
1175952188 20:62589385-62589407 CCCTCGTGCCCTTGCCCTGCTGG - Intergenic
1178283557 21:31305932-31305954 CCCTGGGGGACTTGCCCTTTGGG - Intronic
1179167579 21:38946799-38946821 CCCTGGGGCTCCTGCCCTACAGG - Intergenic
1179473639 21:41629296-41629318 ACCTGGGGCCCTTCCCCACCTGG + Intergenic
1179520629 21:41942119-41942141 CCCAGGAGCCCATTCCCTGCAGG - Intronic
1179899246 21:44380415-44380437 CCCTGGAGCCCTCTCTCTGCTGG + Intronic
1179909875 21:44442062-44442084 CCCTGGGACCCTTGGCCATCAGG + Exonic
1181098080 22:20519877-20519899 CCCTGGGGGCCTCCTCCTTCTGG + Intronic
1181420229 22:22792585-22792607 CCCTGTGACCCTTTCCCTGGAGG - Intronic
1181424271 22:22822873-22822895 CCCTGTGGCCCCTTCCCTGGAGG - Intronic
1181491308 22:23262474-23262496 CCCTGGGGCTCTTTCCCCCATGG + Intronic
1181513961 22:23401184-23401206 CCCTGGGGACCTCTCCCCTCAGG - Intergenic
1181797137 22:25318997-25319019 CCCTGGAGCCCTATCACCTCTGG + Intergenic
1182423806 22:30261441-30261463 CCCTGGAGCTCTGTGCCTTCAGG + Intergenic
1183406369 22:37632509-37632531 CCTGGGGGCCCCTTACCTTCTGG - Exonic
1184456953 22:44616299-44616321 CCTTGGAGCCCTCTCCCTTCTGG + Intergenic
1184522138 22:45001065-45001087 CTATGGGGCCCTTGCTCTTCCGG + Intronic
950441806 3:13014916-13014938 CGCTGGGGCCATTTCCCATCTGG - Intronic
950970640 3:17183596-17183618 CTCTTGAGCCCTTTCCCTGCAGG + Intronic
951476927 3:23117072-23117094 CCCTGGGACCCCTTACCTCCTGG - Intergenic
952382256 3:32814804-32814826 CTCTGGGGCCATCTTCCTTCTGG + Intergenic
952882134 3:37991626-37991648 CTCAGGGCCCCTTTCTCTTCCGG - Intronic
953598085 3:44336917-44336939 CCCTGAGGGCCAATCCCTTCTGG - Intergenic
953912742 3:46901124-46901146 CCCTGGGTCCCTTTTCTTCCAGG + Intronic
953988070 3:47460964-47460986 ACCTGGGCCCCTTTTCCTTGGGG + Intronic
954132288 3:48566891-48566913 AGCTGGGGCCCCTTACCTTCTGG + Exonic
954602028 3:51877685-51877707 CCCTGGGCCTCTTTCCTGTCTGG - Intergenic
954680907 3:52345473-52345495 CCCTTGGCCCCTATCCCTGCAGG + Exonic
960270373 3:115667607-115667629 CTCTGGGGCCCTCTTCCTGCTGG + Intronic
961332950 3:126153725-126153747 CCCTGAGGCCCTTTCTCCTGGGG + Intronic
962476736 3:135761595-135761617 CCATGGGGCCCTTAGACTTCAGG + Intergenic
962484600 3:135830323-135830345 CCCTGGCGCCCCTTCCCCACTGG - Intergenic
963025858 3:140917987-140918009 CCCTGGGCTCCTTTCCCTGATGG - Intergenic
964683153 3:159364804-159364826 TGATGTGGCCCTTTCCCTTCAGG + Intronic
966916615 3:184587807-184587829 CCCTGAATCCCTCTCCCTTCTGG + Intronic
968585661 4:1414862-1414884 CCCCAGGGGCCGTTCCCTTCCGG + Intergenic
969720147 4:8889025-8889047 CCCTGCTGCCCTTGCCTTTCTGG - Intergenic
972264028 4:37441402-37441424 CCCTAGGGCCCTTTTCCTTGTGG + Intronic
976704492 4:88007350-88007372 TCCAGGAGCCCTTTCCCTGCAGG + Intergenic
981748089 4:148069796-148069818 CCCTGGGCCCCTTGCCACTCAGG + Intronic
982068207 4:151673031-151673053 GCCAGGTGCCCTTTCCCTTTGGG - Intronic
985700896 5:1371754-1371776 CCCAGGAGACCTTGCCCTTCTGG - Intergenic
985790770 5:1925942-1925964 CCCTGGAGCTCTGTGCCTTCTGG + Intergenic
987290683 5:16505620-16505642 CCTAGGGTCCCTCTCCCTTCAGG + Intronic
988680911 5:33482844-33482866 CTCTTGAGCCCTTTCCCTTAGGG + Intergenic
988930763 5:36033806-36033828 CCATGGGGACTTTTCCCTTCTGG - Intergenic
991060134 5:62365946-62365968 CTCTGCAGCACTTTCCCTTCTGG + Intronic
991998066 5:72407962-72407984 CCCAGGTCCCCTTTCCCTACAGG - Intergenic
992003436 5:72456338-72456360 CCTGGGGACCCTTTCCCATCAGG + Intronic
998080877 5:139274093-139274115 CCCGGCTGCCCTTTCCCCTCCGG + Exonic
999634172 5:153602893-153602915 CCCTCGTGCCCTTTGTCTTCAGG + Intronic
999975685 5:156909748-156909770 CCCATGTGCCCTGTCCCTTCAGG - Intergenic
1000035841 5:157447356-157447378 CCCAGGGGCCTTTGCCCATCAGG + Intronic
1002523475 5:179803753-179803775 CCGTGGGGCCCTTTATCTCCTGG - Intronic
1003118887 6:3304108-3304130 CCACGGAGCCCTTGCCCTTCAGG + Intronic
1005922695 6:30415948-30415970 CCCTGGGGCCCAATTCCTTTGGG - Intergenic
1006166237 6:32067459-32067481 CCCTGGGGGCCTTTCCCATATGG + Intronic
1006388697 6:33746432-33746454 GCCTGGAGCCCTCTCACTTCAGG - Intronic
1006613855 6:35311797-35311819 CCCTGGGGATCTTTCCCTTGTGG - Intronic
1011262881 6:85486950-85486972 TCCTGGGCCCCTTTCCCATCTGG - Intronic
1015189905 6:130461111-130461133 CACTGCCTCCCTTTCCCTTCTGG + Intergenic
1015921775 6:138273704-138273726 CTCTGGGGCACTTTCCTTACTGG + Intronic
1016062588 6:139646049-139646071 CCCTGTGACTCTTTCTCTTCTGG + Intergenic
1018934038 6:168261560-168261582 GCCTTGGGCCGTGTCCCTTCTGG + Intergenic
1018961641 6:168453299-168453321 CCCTGCGGCCCTGTCATTTCGGG + Intronic
1019135360 6:169904454-169904476 CCCTGGGGCCTTTTGGGTTCAGG + Intergenic
1019729388 7:2622111-2622133 CCTTGGGGCCCTTCCCATCCTGG - Intergenic
1022440745 7:30430859-30430881 CCCAGGGGCCCTAGCCCTTGTGG - Intronic
1022842612 7:34179204-34179226 CACTGGGCTCCTTTTCCTTCTGG + Intergenic
1026335293 7:69389243-69389265 CCCTGTGTCCCTGTCACTTCAGG - Intergenic
1026586538 7:71660378-71660400 GCCTGGGGCGCTTTCCATTTGGG + Intronic
1026661752 7:72308845-72308867 CCCTGGGGATCATTCCCATCTGG + Intronic
1026735542 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG + Intronic
1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG + Intergenic
1027108184 7:75418630-75418652 CCCTGGGGCCCTTTCCCTTCTGG - Exonic
1028515624 7:91675050-91675072 GCCTGGCTCTCTTTCCCTTCTGG + Intergenic
1028710981 7:93907831-93907853 CCCTGTTGCCCTTTCCATACAGG + Intronic
1030103126 7:105963439-105963461 CCCAGGGGCAATTTCCTTTCTGG - Intronic
1031954057 7:127924074-127924096 CCCTGGAGTCCTTTACCCTCAGG + Intronic
1032959547 7:137015645-137015667 CCCTGGGGGCTTTGCCATTCTGG - Exonic
1033542745 7:142372337-142372359 TCCTGTGGTCCTTCCCCTTCAGG - Intergenic
1035382233 7:158447491-158447513 CCCTGGGGCCCTGCTGCTTCTGG - Intronic
1035388662 7:158490616-158490638 CCCTGGGGCCCTCCCGGTTCTGG - Intronic
1035998937 8:4580207-4580229 CCCTGCTGCCCTTCCCCTTGTGG + Intronic
1036645575 8:10609830-10609852 TCCTGGGAGCCTTTCCCATCCGG + Exonic
1037307347 8:17519529-17519551 CCCTTTGGCCCTGTCCCTCCGGG + Intronic
1037490834 8:19395653-19395675 CCTTGGTGTCCCTTCCCTTCCGG - Exonic
1037809833 8:22080801-22080823 CCCTCTGGCCCTCTCCGTTCTGG - Exonic
1041342545 8:56861152-56861174 TCCTGGGCCCGTTTCCATTCTGG + Intergenic
1041552753 8:59119479-59119501 CCCTCCCGCCCTGTCCCTTCTGG - Intergenic
1041975373 8:63793605-63793627 CCCTGGGACCCTGTGTCTTCCGG - Intergenic
1042591464 8:70402686-70402708 CCCCGAGGGCCTGTCCCTTCAGG + Intronic
1042944898 8:74144970-74144992 CCCTGGGTTCCTTTCTCTTCTGG + Intergenic
1044616276 8:94145754-94145776 TCCTGGGGCTTTTTCCCCTCTGG + Intronic
1047223729 8:122939481-122939503 CACTGGGTCCCCTTCCCTTTGGG - Intronic
1049062636 8:140287677-140287699 CCCTGCGGCGCTTTCTCTTCCGG - Exonic
1049268300 8:141681264-141681286 CCCTGGGCCCCTGCCCCATCAGG + Intergenic
1049284365 8:141766637-141766659 CCATGGGACCCTTTTCATTCTGG - Intergenic
1049472611 8:142783115-142783137 GCAAGGGGCCCTTCCCCTTCTGG + Intergenic
1049476259 8:142798247-142798269 CCCTGCCTCCCTTTCCCTACGGG - Intergenic
1050483519 9:6110424-6110446 CCCTCTGGCCTTTTCACTTCTGG + Intergenic
1052932499 9:34067261-34067283 ACCTGGTGCCCTGCCCCTTCTGG - Intergenic
1053091182 9:35278547-35278569 ACCTGGGGACCTATGCCTTCTGG - Intronic
1057353564 9:94318715-94318737 CCCTGGGGTCCTCTCCCTCCTGG + Exonic
1057566920 9:96173009-96173031 GCCTGGGGCCCTTTGCTTTGTGG - Intergenic
1057654187 9:96938877-96938899 CCCTGGGGTCCTCTCCCTCCTGG - Exonic
1058504737 9:105656166-105656188 CCCGGGGGCCCCTTCCCGACGGG - Intergenic
1059344201 9:113617025-113617047 CCCTGGGGCCCTTCACCTTGTGG - Intergenic
1061494035 9:130961534-130961556 CCCTCGATCCATTTCCCTTCAGG - Intergenic
1061562963 9:131418272-131418294 CCCTGGCCCCCTCTTCCTTCTGG + Intronic
1061566724 9:131445673-131445695 TCCTGGGTCTCTTTCCCTTAAGG + Intronic
1062169268 9:135125694-135125716 CCATGGGTCCTTTTGCCTTCTGG - Intergenic
1062237151 9:135515743-135515765 CCCAGGGTCCCTCGCCCTTCCGG - Intergenic
1062469225 9:136695025-136695047 GCCCCGGGCCCTTTGCCTTCAGG + Intergenic
1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG + Exonic
1062735374 9:138134535-138134557 CCGTGGGGCCCAGTGCCTTCTGG + Intergenic
1185461284 X:333757-333779 CCCTCGGGGCCGTTCCCTCCCGG - Intergenic
1186233132 X:7477757-7477779 CCCTTGGTTCCTTTCCTTTCGGG - Intergenic
1186611552 X:11142815-11142837 CACAGGGCCTCTTTCCCTTCTGG - Intronic
1189048422 X:37618110-37618132 CTCTGGGCCCCTCTCCCTGCAGG + Intronic
1190495568 X:51025520-51025542 GCCTGCTGCCCTCTCCCTTCCGG - Intergenic
1192221092 X:69197804-69197826 CCCTGGGGCCTTTGCAGTTCTGG - Intergenic
1194241314 X:91452963-91452985 CCCTGGGTTCCTTTACCTTAAGG + Intergenic
1199690908 X:150308521-150308543 CCCTGGGGAGCTTCCACTTCTGG - Intergenic
1200397347 X:155999015-155999037 CCCTTGGGCCCTGTCAGTTCAGG + Intronic
1200412689 Y:2877184-2877206 GACAGGGGCCCTTTCCTTTCTGG - Intronic
1202069498 Y:20976107-20976129 CCCTGTGGGCATTTCTCTTCAGG + Intergenic