ID: 1026735558

View in Genome Browser
Species Human (GRCh38)
Location 7:72946421-72946443
Sequence AAGGGGAAGCAGGATGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026735543_1026735558 19 Left 1026735543 7:72946379-72946401 CCTGGGGCCCTTTCCCTTCTGGA 0: 3
1: 0
2: 1
3: 25
4: 258
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data
1026735546_1026735558 11 Left 1026735546 7:72946387-72946409 CCTTTCCCTTCTGGAGGAAGCAC 0: 3
1: 0
2: 4
3: 21
4: 261
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data
1026735547_1026735558 6 Left 1026735547 7:72946392-72946414 CCCTTCTGGAGGAAGCACAAGCC 0: 3
1: 0
2: 3
3: 20
4: 174
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data
1026735541_1026735558 20 Left 1026735541 7:72946378-72946400 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 41
4: 279
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data
1026735548_1026735558 5 Left 1026735548 7:72946393-72946415 CCTTCTGGAGGAAGCACAAGCCT 0: 3
1: 0
2: 2
3: 21
4: 166
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data
1026735545_1026735558 12 Left 1026735545 7:72946386-72946408 CCCTTTCCCTTCTGGAGGAAGCA 0: 3
1: 0
2: 4
3: 30
4: 295
Right 1026735558 7:72946421-72946443 AAGGGGAAGCAGGATGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026735558 Original CRISPR AAGGGGAAGCAGGATGCGGA GGG Intronic
No off target data available for this crispr