ID: 1026737382

View in Genome Browser
Species Human (GRCh38)
Location 7:72957645-72957667
Sequence CCCTCAGACCATAAGTGGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 2, 1: 0, 2: 0, 3: 10, 4: 101}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026737378_1026737382 -3 Left 1026737378 7:72957625-72957647 CCAGAAGAGGAGCCTGGAGGCCC No data
Right 1026737382 7:72957645-72957667 CCCTCAGACCATAAGTGGTGAGG 0: 2
1: 0
2: 0
3: 10
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026737382 Original CRISPR CCCTCAGACCATAAGTGGTG AGG Intergenic
905168178 1:36095791-36095813 CTCTCAAACCATACCTGGTGGGG - Exonic
905605996 1:39300747-39300769 CCCTAAGAGCATAAGTGGCTGGG + Intronic
912655334 1:111481547-111481569 CCTTGACACCATAAGTGCTGTGG - Intergenic
914847887 1:151292824-151292846 TCCTCAGCCCAGGAGTGGTGGGG - Exonic
915167658 1:153957665-153957687 CCGTCCGACCATAAGTTGTGTGG - Intronic
915665190 1:157437875-157437897 CCCCAAGACCATAAGAGGTGGGG + Intergenic
917623643 1:176823768-176823790 CCCTCAGCCCATAATAAGTGAGG + Intronic
922351730 1:224739600-224739622 CCTTCTGAGCATCAGTGGTGTGG + Exonic
923754942 1:236783624-236783646 CCCTCAGAAAATGAGTGGAGTGG - Intergenic
1062932254 10:1361073-1361095 GCCCCAGACCATGGGTGGTGGGG + Intronic
1077486378 11:2840405-2840427 CCATCATTCCATAAGTGGTGGGG + Intronic
1078512773 11:11997854-11997876 CCATCAGACCAAAAGACGTGGGG + Intronic
1081042492 11:38228613-38228635 CCTTCAGACCATGAGTTGTCTGG + Intergenic
1089293029 11:117449920-117449942 CCCTCAGAGCATCAGTGGAAGGG + Intronic
1090010055 11:123038232-123038254 CCCTCAGCATATAAGAGGTGAGG - Intergenic
1091537302 12:1423310-1423332 GCCTTAGGCCATAAGTGGTGGGG - Intronic
1091828057 12:3529831-3529853 CCCATAGAGCATAACTGGTGAGG - Intronic
1093684192 12:22038062-22038084 CCCACAGACTATAAGTGCTCAGG + Intergenic
1095767634 12:45914511-45914533 CCCTCATACCACAAGCAGTGAGG + Intergenic
1096261977 12:50098707-50098729 CCCTCAGACAATGACTGATGTGG + Exonic
1104175949 12:126332927-126332949 ACCTGAGACCATAAGTGCTATGG - Intergenic
1105297304 13:19099663-19099685 CCCTTAGACCATAATGGGGGTGG + Intergenic
1111658885 13:91184572-91184594 TCCTCCGACCATAAGTGTTATGG - Intergenic
1112399533 13:99063612-99063634 CTCTCAAACCATGTGTGGTGAGG + Intronic
1116826385 14:49677217-49677239 CCCTCAGACAGTAAGCCGTGAGG - Intronic
1118640804 14:67790537-67790559 TGCTAACACCATAAGTGGTGAGG - Intronic
1120912005 14:89675829-89675851 CTCTCAGACCAACAGTGCTGTGG + Intergenic
1121906951 14:97754850-97754872 TCCTCAGACCATAAGAGGCAAGG + Intronic
1122549593 14:102542942-102542964 CCCTCAGCCCATAAGAGCTCTGG + Intergenic
1123063944 14:105606790-105606812 CCCTCAGACAGGAAGGGGTGGGG - Intergenic
1123073258 14:105652433-105652455 CCCTCAGACAGGAAGGGGTGGGG - Intergenic
1125222576 15:37356297-37356319 CACTCAGACCATGAGTGGAATGG - Intergenic
1128252445 15:66172599-66172621 GCCTCAGACCTGAAGGGGTGAGG - Intronic
1130464554 15:84185266-84185288 CCCGCAGACCATATGCGCTGGGG - Intergenic
1130499713 15:84488271-84488293 CCCGCAGACCATATGCGCTGGGG + Intergenic
1134023293 16:10936726-10936748 CCCTCAAACCCTCAGTGCTGTGG + Intronic
1135752175 16:25066555-25066577 CCATCAGATCATTCGTGGTGTGG - Intergenic
1139472058 16:67183710-67183732 CCTGCAGCCAATAAGTGGTGGGG + Exonic
1141166086 16:81661875-81661897 CACTCAGACCAGAAGGTGTGTGG - Intronic
1145112011 17:20172200-20172222 CCCTGAGGCCAGAAGGGGTGTGG - Intronic
1148559708 17:48598874-48598896 CCCTCAGACCAGAAGGGTTGTGG - Intronic
1149022917 17:51990994-51991016 CACACAGCCCTTAAGTGGTGAGG - Intronic
1149316702 17:55445176-55445198 CCCTCAGGCCAGAAATGGTCAGG - Intergenic
1150724033 17:67636995-67637017 CCTCCAGACCAGCAGTGGTGGGG - Intronic
1151527555 17:74681332-74681354 CCCTCTGACCTTCAGAGGTGGGG - Intronic
1151796370 17:76348956-76348978 CACTCTGACCAAATGTGGTGTGG + Intronic
1153427164 18:4977782-4977804 TCCTCAGACCATGAGTAGTGTGG - Intergenic
1153600203 18:6773606-6773628 CCTTCTGACCATAAGTTGCGTGG + Intronic
1156838682 18:41585753-41585775 CCCTGAGGCCAGGAGTGGTGAGG + Intergenic
1158167938 18:54562560-54562582 TACTGAGACCAAAAGTGGTGTGG - Intergenic
1160437220 18:78860904-78860926 CCTTCATCCCATATGTGGTGTGG + Intergenic
1164826230 19:31286802-31286824 CCCTCAGCTCACCAGTGGTGTGG + Intronic
1165152902 19:33771442-33771464 CTCTCAGAACTTACGTGGTGGGG - Exonic
1167419448 19:49394567-49394589 CCCTCAGAGGACAGGTGGTGGGG + Exonic
929567668 2:42999887-42999909 CCCTCACACAAGTAGTGGTGGGG - Intergenic
930391416 2:50766247-50766269 ACCTCAGACCATAAATCATGGGG - Intronic
931771721 2:65503337-65503359 TCCTCAGAAGAGAAGTGGTGGGG - Intergenic
934618862 2:95792035-95792057 CACTTAGGCCATTAGTGGTGAGG - Intergenic
934642031 2:96032522-96032544 CACTTAGGCCATTAGTGGTGAGG + Intronic
942415829 2:175758326-175758348 CCCTCAGCCCACAAATGTTGGGG + Intergenic
946141350 2:217693537-217693559 CCCGCAGACCCTAAATTGTGAGG + Intronic
947941552 2:234060509-234060531 CACACAGACCCTAAGAGGTGCGG - Intronic
1171337239 20:24395406-24395428 CACTGAGACCAGAGGTGGTGGGG + Intergenic
1176136269 20:63523371-63523393 CCCCCAGGCCATGTGTGGTGGGG - Intergenic
1177077165 21:16590254-16590276 CCCTGAGACCCTAACTTGTGAGG + Intergenic
1182481815 22:30614196-30614218 GCCTCAGCCCATACGTGCTGAGG - Intronic
950189463 3:10966591-10966613 TCCTCAGGCCATATGTGGTGCGG - Intergenic
950965862 3:17145322-17145344 GGCTCAGACCAAAGGTGGTGAGG - Intergenic
955543482 3:60002541-60002563 CCCTCAGGCCAAACATGGTGAGG - Intronic
960544321 3:118894971-118894993 CCCTATGACAACAAGTGGTGTGG + Intergenic
960944042 3:122953833-122953855 CCCTTTGACCATAAATGGAGGGG - Intronic
961634057 3:128321825-128321847 CCCTGTCACCACAAGTGGTGAGG + Intronic
968916153 4:3497849-3497871 CCACCAGACCAGAGGTGGTGGGG + Intronic
969286433 4:6205222-6205244 CCCTGAGCCCACAAGTGGTAGGG + Intergenic
969499066 4:7542140-7542162 CCCTCCGCCCATGAGGGGTGAGG - Intronic
971064519 4:23015136-23015158 CCCTCAGACCACAATTTGTTGGG + Intergenic
971378415 4:26074067-26074089 CCCGCAAGTCATAAGTGGTGGGG + Intergenic
974460746 4:62184668-62184690 GCGTCAGACCATAAGTGGTTGGG - Intergenic
974803302 4:66847273-66847295 CCATCAAACCATAGGTGGGGTGG + Intergenic
976067455 4:81204966-81204988 TCCGCAGAGCATCAGTGGTGAGG + Exonic
980266033 4:130517258-130517280 ACCCCAGACCATAAGTGCTATGG + Intergenic
987328500 5:16834168-16834190 CGCTCAGACTAGATGTGGTGGGG - Intronic
987955316 5:24731034-24731056 CAACCAGACCATAAGTGCTGAGG + Intergenic
997266553 5:132498186-132498208 CCCTCAGCCCAGAAGAGCTGGGG + Intergenic
998734337 5:145118362-145118384 GCCTCAGGCCATAACTAGTGAGG - Intergenic
999008379 5:148006714-148006736 CTCTCTGGCCATAAGTGCTGGGG + Intergenic
1000521481 5:162299976-162299998 CCCTCACACCAATGGTGGTGGGG + Intergenic
1002880862 6:1251231-1251253 TCCTCACACCATGAGAGGTGTGG + Intergenic
1004825117 6:19411525-19411547 CCATCAAACCAGTAGTGGTGGGG - Intergenic
1005500407 6:26424331-26424353 CCATCAGACCAGAGGAGGTGAGG + Intergenic
1005667435 6:28072250-28072272 CACTCAGCCCACAAGTGATGAGG + Intergenic
1011977114 6:93316178-93316200 CCCTCAAACCATAACTGGTAAGG + Intronic
1014011566 6:116482081-116482103 CACTCAGTCCAGAAGTGGGGTGG + Intergenic
1017549962 6:155495484-155495506 CCCTCAGGCCAGCAGAGGTGGGG + Intergenic
1019482836 7:1274325-1274347 CCCGCAGGCCTGAAGTGGTGGGG + Intergenic
1019638375 7:2089001-2089023 CCTTCAGGCCATCAGTGGAGTGG - Intronic
1023383778 7:39634488-39634510 CCCTCAGACTAAAAATGGTGGGG - Intronic
1024009178 7:45253165-45253187 CCCTCAGACCTCAAGGGATGTGG - Intergenic
1026737382 7:72957645-72957667 CCCTCAGACCATAAGTGGTGAGG + Intergenic
1027106350 7:75407423-75407445 CCCTCAGACCATAAGTGGTGAGG - Intronic
1027981677 7:85232178-85232200 CCCTCAGCCTATCAGTGCTGGGG + Intergenic
1028997734 7:97119903-97119925 CCCTCTGACATTAAGTGTTGAGG - Intronic
1034243515 7:149626975-149626997 TCCTCGGACCAGAAGTGGAGAGG + Intergenic
1036073656 8:5470632-5470654 CACTGAGACCACAAGAGGTGAGG + Intergenic
1040674928 8:49737008-49737030 CTATCAGAACATATGTGGTGAGG - Intergenic
1040929175 8:52715733-52715755 CACACAGAAAATAAGTGGTGAGG + Intronic
1041834592 8:62197528-62197550 GCCACAGAGCATAAGGGGTGGGG + Intergenic
1048305091 8:133278533-133278555 ACCTCAGCACATGAGTGGTGCGG + Intronic
1058443939 9:105036859-105036881 CCGTCAGACCATTAGTATTGGGG - Intergenic
1060768022 9:126309497-126309519 GCCTGAGACCATTAGTGGAGTGG - Intergenic
1061607723 9:131723930-131723952 CCCACAGAAAATAAGTGTTGTGG - Intronic
1186293730 X:8125957-8125979 CTCTCAGAGCCTCAGTGGTGGGG + Intergenic
1195761108 X:108247481-108247503 CCCTCAGACCATGTCTGCTGGGG + Intronic