ID: 1026760231

View in Genome Browser
Species Human (GRCh38)
Location 7:73121186-73121208
Sequence CACCCTATAGAGTTGTTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026760231_1026760238 15 Left 1026760231 7:73121186-73121208 CCTTCCAACAACTCTATAGGGTG No data
Right 1026760238 7:73121224-73121246 ATTAACAGAGAAGGAAAATGAGG No data
1026760231_1026760235 6 Left 1026760231 7:73121186-73121208 CCTTCCAACAACTCTATAGGGTG No data
Right 1026760235 7:73121215-73121237 ATCACCCATATTAACAGAGAAGG No data
1026760231_1026760239 16 Left 1026760231 7:73121186-73121208 CCTTCCAACAACTCTATAGGGTG No data
Right 1026760239 7:73121225-73121247 TTAACAGAGAAGGAAAATGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026760231 Original CRISPR CACCCTATAGAGTTGTTGGA AGG (reversed) Intergenic
No off target data available for this crispr