ID: 1026764619

View in Genome Browser
Species Human (GRCh38)
Location 7:73152720-73152742
Sequence CCCAAACAGAAATGCATTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026764619_1026764624 13 Left 1026764619 7:73152720-73152742 CCCTGAATGCATTTCTGTTTGGG No data
Right 1026764624 7:73152756-73152778 TAGATTCTAAAGGCATAGATAGG No data
1026764619_1026764623 3 Left 1026764619 7:73152720-73152742 CCCTGAATGCATTTCTGTTTGGG No data
Right 1026764623 7:73152746-73152768 TCTGGATCTCTAGATTCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026764619 Original CRISPR CCCAAACAGAAATGCATTCA GGG (reversed) Intergenic
No off target data available for this crispr