ID: 1026765253

View in Genome Browser
Species Human (GRCh38)
Location 7:73155736-73155758
Sequence CCGGCCCAACCGAGGGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026765253_1026765266 -2 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765266 7:73155757-73155779 GGCCCCGTCGCCACGGCGGGGGG No data
1026765253_1026765264 -4 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765264 7:73155755-73155777 CCGGCCCCGTCGCCACGGCGGGG No data
1026765253_1026765262 -5 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765262 7:73155754-73155776 GCCGGCCCCGTCGCCACGGCGGG No data
1026765253_1026765271 2 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765271 7:73155761-73155783 CCGTCGCCACGGCGGGGGGAGGG No data
1026765253_1026765261 -6 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765261 7:73155753-73155775 GGCCGGCCCCGTCGCCACGGCGG No data
1026765253_1026765269 1 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765269 7:73155760-73155782 CCCGTCGCCACGGCGGGGGGAGG No data
1026765253_1026765265 -3 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765265 7:73155756-73155778 CGGCCCCGTCGCCACGGCGGGGG No data
1026765253_1026765273 18 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765273 7:73155777-73155799 GGGAGGGATTCCGCTGAGCGCGG No data
1026765253_1026765260 -9 Left 1026765253 7:73155736-73155758 CCCCCATCCCTCGGTTGGGCCGG No data
Right 1026765260 7:73155750-73155772 TTGGGCCGGCCCCGTCGCCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026765253 Original CRISPR CCGGCCCAACCGAGGGATGG GGG (reversed) Intergenic