ID: 1026776543

View in Genome Browser
Species Human (GRCh38)
Location 7:73234697-73234719
Sequence AGCGGGGGGCGCCGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026776531_1026776543 24 Left 1026776531 7:73234650-73234672 CCTGCAAAAGTCAGGGCAAGACG No data
Right 1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG No data
1026776534_1026776543 -3 Left 1026776534 7:73234677-73234699 CCAGGCCCAACGCCAGATCAAGC No data
Right 1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG No data
1026776540_1026776543 -9 Left 1026776540 7:73234683-73234705 CCAACGCCAGATCAAGCGGGGGG No data
Right 1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG No data
1026776538_1026776543 -8 Left 1026776538 7:73234682-73234704 CCCAACGCCAGATCAAGCGGGGG No data
Right 1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG No data
1026776533_1026776543 -2 Left 1026776533 7:73234676-73234698 CCCAGGCCCAACGCCAGATCAAG No data
Right 1026776543 7:73234697-73234719 AGCGGGGGGCGCCGCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026776543 Original CRISPR AGCGGGGGGCGCCGCCCCGC AGG Intergenic
No off target data available for this crispr