ID: 1026776705 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:73235198-73235220 |
| Sequence | GGTGGATGCTGTGCACGTTG CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 206 | |||
| Summary | {0: 1, 1: 1, 2: 2, 3: 17, 4: 185} |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026776705_1026776710 | 4 | Left | 1026776705 | 7:73235198-73235220 | CCGCAACGTGCACAGCATCCACC | 0: 1 1: 1 2: 2 3: 17 4: 185 |
||
| Right | 1026776710 | 7:73235225-73235247 | GTCGCGGAAGCGCCTCAGCCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026776705 | Original CRISPR | GGTGGATGCTGTGCACGTTG CGG (reversed) | Intergenic | ||