ID: 1026776705

View in Genome Browser
Species Human (GRCh38)
Location 7:73235198-73235220
Sequence GGTGGATGCTGTGCACGTTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 1, 2: 2, 3: 17, 4: 185}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026776705_1026776710 4 Left 1026776705 7:73235198-73235220 CCGCAACGTGCACAGCATCCACC 0: 1
1: 1
2: 2
3: 17
4: 185
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026776705 Original CRISPR GGTGGATGCTGTGCACGTTG CGG (reversed) Intergenic