ID: 1026776710

View in Genome Browser
Species Human (GRCh38)
Location 7:73235225-73235247
Sequence GTCGCGGAAGCGCCTCAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026776700_1026776710 30 Left 1026776700 7:73235172-73235194 CCGTCCCGCTGGGCCAGGTCGTC No data
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data
1026776702_1026776710 25 Left 1026776702 7:73235177-73235199 CCGCTGGGCCAGGTCGTCCATCC No data
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data
1026776705_1026776710 4 Left 1026776705 7:73235198-73235220 CCGCAACGTGCACAGCATCCACC 0: 1
1: 1
2: 2
3: 17
4: 185
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data
1026776701_1026776710 26 Left 1026776701 7:73235176-73235198 CCCGCTGGGCCAGGTCGTCCATC No data
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data
1026776704_1026776710 8 Left 1026776704 7:73235194-73235216 CCATCCGCAACGTGCACAGCATC 0: 1
1: 2
2: 0
3: 4
4: 88
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data
1026776703_1026776710 17 Left 1026776703 7:73235185-73235207 CCAGGTCGTCCATCCGCAACGTG 0: 1
1: 2
2: 0
3: 0
4: 16
Right 1026776710 7:73235225-73235247 GTCGCGGAAGCGCCTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026776710 Original CRISPR GTCGCGGAAGCGCCTCAGCC AGG Intergenic