ID: 1026785880

View in Genome Browser
Species Human (GRCh38)
Location 7:73301308-73301330
Sequence CCCTGGGGCCCTTTCCCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026785865_1026785880 21 Left 1026785865 7:73301264-73301286 CCTACCCCGGATCTCTGGCTTCA 0: 3
1: 0
2: 2
3: 22
4: 198
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data
1026785866_1026785880 17 Left 1026785866 7:73301268-73301290 CCCCGGATCTCTGGCTTCAGCCG 0: 3
1: 0
2: 0
3: 7
4: 102
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data
1026785868_1026785880 15 Left 1026785868 7:73301270-73301292 CCGGATCTCTGGCTTCAGCCGCC 0: 3
1: 0
2: 0
3: 23
4: 296
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data
1026785875_1026785880 -6 Left 1026785875 7:73301291-73301313 CCAGGGGGCAGTGGCAGCCCTGG 0: 3
1: 0
2: 8
3: 109
4: 893
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data
1026785867_1026785880 16 Left 1026785867 7:73301269-73301291 CCCGGATCTCTGGCTTCAGCCGC 0: 3
1: 0
2: 4
3: 35
4: 332
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data
1026785874_1026785880 -3 Left 1026785874 7:73301288-73301310 CCGCCAGGGGGCAGTGGCAGCCC 0: 3
1: 0
2: 6
3: 49
4: 453
Right 1026785880 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026785880 Original CRISPR CCCTGGGGCCCTTTCCCTTC TGG Intergenic
No off target data available for this crispr