ID: 1026785896

View in Genome Browser
Species Human (GRCh38)
Location 7:73301351-73301373
Sequence AAGGGGAAGCAGGATGCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026785884_1026785896 11 Left 1026785884 7:73301317-73301339 CCTTTCCCTTCTGGAGGAAGCAC 0: 3
1: 0
2: 4
3: 21
4: 261
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data
1026785883_1026785896 12 Left 1026785883 7:73301316-73301338 CCCTTTCCCTTCTGGAGGAAGCA 0: 3
1: 0
2: 4
3: 30
4: 295
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data
1026785881_1026785896 19 Left 1026785881 7:73301309-73301331 CCTGGGGCCCTTTCCCTTCTGGA 0: 3
1: 0
2: 1
3: 25
4: 258
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data
1026785885_1026785896 6 Left 1026785885 7:73301322-73301344 CCCTTCTGGAGGAAGCACAAGCC 0: 3
1: 0
2: 3
3: 20
4: 174
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data
1026785886_1026785896 5 Left 1026785886 7:73301323-73301345 CCTTCTGGAGGAAGCACAAGCCT 0: 3
1: 0
2: 2
3: 21
4: 166
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data
1026785879_1026785896 20 Left 1026785879 7:73301308-73301330 CCCTGGGGCCCTTTCCCTTCTGG 0: 3
1: 0
2: 2
3: 41
4: 279
Right 1026785896 7:73301351-73301373 AAGGGGAAGCAGGATGCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026785896 Original CRISPR AAGGGGAAGCAGGATGCGGA GGG Intergenic
No off target data available for this crispr