ID: 1026786292

View in Genome Browser
Species Human (GRCh38)
Location 7:73303740-73303762
Sequence ATTGGGGCCGTTTCTCTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 2, 2: 0, 3: 2, 4: 70}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026786292_1026786301 26 Left 1026786292 7:73303740-73303762 CCTGCAAGAGAAACGGCCCCAAT 0: 1
1: 2
2: 0
3: 2
4: 70
Right 1026786301 7:73303789-73303811 TCCCCCACTCCCCACGACCCTGG 0: 1
1: 0
2: 4
3: 40
4: 406

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026786292 Original CRISPR ATTGGGGCCGTTTCTCTTGC AGG (reversed) Exonic