ID: 1026786668

View in Genome Browser
Species Human (GRCh38)
Location 7:73305969-73305991
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 3, 1: 0, 2: 4, 3: 49, 4: 390}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026786662_1026786668 5 Left 1026786662 7:73305941-73305963 CCAACGAAGGACAAAACGAGACA 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG 0: 3
1: 0
2: 4
3: 49
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900120491 1:1046711-1046733 GAGGCCAGTGGGGGTGGCTCTGG + Exonic
900185496 1:1331363-1331385 GAGCCCAGAGGCTGAGGCCCAGG - Exonic
900481344 1:2900924-2900946 GGGCCCAGAGCAGCAGGCACAGG - Intergenic
900600835 1:3502049-3502071 GAGCCCATGTGAGGAGGCGCCGG - Intronic
900600846 1:3502088-3502110 GAGCCCATGTGAGGAGGCGCGGG - Intronic
900721548 1:4179181-4179203 GAGCACTGTGGAGGAGGGGCAGG - Intergenic
901379856 1:8865847-8865869 AAGCCCAGTGGAGGCAGCCCGGG + Intronic
901422474 1:9160417-9160439 GAGCCCAATGGGAGAGGAACTGG + Intergenic
901769488 1:11523007-11523029 GTTCCCAGAGGAAGAGGCACAGG - Intronic
901815557 1:11791484-11791506 GAGGCCAGGAGCGGAGGCACAGG - Intronic
902106267 1:14038615-14038637 GAGCCCAGGGAGGAAGGCACTGG - Intergenic
902571487 1:17349860-17349882 GAGGCCAGTGGAGGTGGGGCTGG - Intronic
902619683 1:17643692-17643714 GAGCCCTGTGCAGGGGGCACTGG - Intronic
903181295 1:21606208-21606230 GGTGGCAGTGGAGGAGGCACAGG + Intronic
903687609 1:25143386-25143408 GACCTCTGAGGAGGAGGCACTGG - Intergenic
903950765 1:26994591-26994613 GGGCCCAGTAGAGGAGGCTGAGG + Exonic
904081668 1:27876327-27876349 GAACTCAGTGGAGGAGGCACGGG + Intronic
904473289 1:30748797-30748819 GAGCCCAGTGGAGGGAGGAGGGG - Intronic
905481449 1:38264755-38264777 AAGAACAATGGAGGAGGCACAGG - Intergenic
905791384 1:40791526-40791548 GTGCCCTGGGGATGAGGCACAGG + Intronic
907319807 1:53595091-53595113 AAGCCCAGGGCAGGAGGCAGAGG + Intronic
908105151 1:60833688-60833710 GACCCCAGGGGTGGAGGCAGAGG + Intergenic
909916108 1:81321588-81321610 GAGACCAGTGGATGAGCAACTGG + Intronic
911038262 1:93572240-93572262 GGGCTCAGTGGAGGTGGCCCTGG - Intronic
912675515 1:111676718-111676740 GGGGCCAGTGGTGGTGGCACAGG - Intronic
913565084 1:120065497-120065519 GAGGACAGTGAATGAGGCACTGG + Intronic
914677974 1:149918208-149918230 GAGAGCAGTGGAGAAGGCAAGGG - Intergenic
914778375 1:150759850-150759872 GAGCCCAGTCCCAGAGGCACTGG + Intronic
915462117 1:156076533-156076555 GGGCCCAGTGGAGTGGGCCCCGG + Exonic
915514009 1:156402217-156402239 GAGGCCAGGAGAGGAGGCAGAGG + Intergenic
917733908 1:177902944-177902966 GAGCTCTTTGGAGGAGGCAAAGG + Intergenic
920208105 1:204307775-204307797 GAGCCCAGAGGTGCAGGCACTGG + Intronic
920274777 1:204796016-204796038 GATCTCAGTGGAGGAGGAGCAGG - Intergenic
920503148 1:206497969-206497991 GAGCTCAGTGAAGGAGCCAGGGG + Intergenic
921157203 1:212447807-212447829 AACCCCAGGGGAGGAGGCACAGG + Intergenic
922921610 1:229309912-229309934 CAGCACAGTGGATGAGGAACTGG + Intergenic
922937867 1:229434843-229434865 GAGCGCCGGGGAGGAGGCGCGGG + Intergenic
924116707 1:240754241-240754263 CATCCCAGAGGAGGGGGCACAGG - Intergenic
924309428 1:242724802-242724824 GAGTCCAGTGGAGGGGGAATTGG + Intergenic
924359217 1:243218370-243218392 GGCCCCAGTGGAGGAGGCAGGGG + Intronic
1062795935 10:345273-345295 GAGTCTAGTTGTGGAGGCACGGG + Intronic
1063540892 10:6932754-6932776 GCTCCCAATGGAGGAAGCACTGG - Intergenic
1064167826 10:13001686-13001708 GAGCCCCGTGGCGGAGACAGCGG - Exonic
1065024284 10:21526234-21526256 GAGCCGAGGGGAGGGGGCGCCGG + Intergenic
1067092230 10:43273701-43273723 GAGACCAGTGGAGAAGGGCCTGG + Intergenic
1067102404 10:43342832-43342854 GGGCCCAGCGCAGCAGGCACTGG - Intergenic
1069752139 10:70751631-70751653 AAGGCCTGTGGAGGAGGTACCGG + Exonic
1070792085 10:79195561-79195583 GAGCCCGGAGGCGGAGGCAGCGG + Intronic
1072616976 10:97056570-97056592 GAGCCCATCGGAGCAGGCCCAGG + Intronic
1072620703 10:97077311-97077333 AAGCCTAGTGGAGGTGGCAAAGG - Intronic
1074478138 10:113791606-113791628 GAGCTAAGTGGAGGAGGCGTGGG + Intergenic
1074563884 10:114559091-114559113 GAGACCAATGGAGGAGGGGCTGG - Intronic
1075161445 10:120028047-120028069 GGGCCCATTGGAGGAGGCCTTGG + Intergenic
1075220669 10:120581715-120581737 GAGCCCAGTTTAGGAGGGAGAGG - Intronic
1075220817 10:120582855-120582877 GAGCCCAGTGGAGAACACGCCGG - Intronic
1076008034 10:126963774-126963796 CAGTCAAGTGGAAGAGGCACAGG + Intronic
1076572171 10:131439961-131439983 GCGCCCAGGTGAGGAGGCCCTGG - Intergenic
1076683053 10:132185204-132185226 GAGCCCAGAGGAGGACGAAGGGG + Intergenic
1076714359 10:132355822-132355844 GAGCCCAGAGGATGAGGAAGAGG + Exonic
1076905867 10:133360707-133360729 GGGCCAAGTGGAGGAGACACCGG + Intergenic
1077048945 11:558149-558171 GAGCCCAGTGGGTGAGGCAGGGG - Exonic
1077374534 11:2199345-2199367 GAGCCCAGTGGAGACGGAGCTGG - Intergenic
1077411758 11:2406988-2407010 GAGCCCAGCTGAGGACCCACAGG + Intronic
1077672147 11:4166666-4166688 GAGCCCAGTGAGAAAGGCACAGG - Intergenic
1078740367 11:14060378-14060400 GAGCCCAGTGGAGAAGGGTATGG + Intronic
1079095241 11:17505763-17505785 GAGCCCAGGGGAGGTAGCCCTGG + Intronic
1081809025 11:45905056-45905078 GATGGCAGTGGAGGAGGCACGGG + Intronic
1081931546 11:46875012-46875034 GATGCCAGTGGGGCAGGCACAGG + Exonic
1081933590 11:46889442-46889464 GAAGCCAGTGGGGCAGGCACAGG + Exonic
1082004920 11:47414158-47414180 GTGCCCAGGGGAGCAGGCCCAGG - Intronic
1083006943 11:59355662-59355684 AGGCCCAGTGGAGCAGTCACAGG - Intergenic
1083096420 11:60255650-60255672 GAGCACATTGGTGGAGGGACTGG + Intergenic
1083642370 11:64152500-64152522 GTGCCCAGAGAAGGAGGGACAGG - Intronic
1083779475 11:64910505-64910527 GAGCACAGGGGAAGAGGGACAGG + Intronic
1083887991 11:65582035-65582057 GAGCCCCTTGGAGGAGCCTCAGG - Exonic
1084097113 11:66918838-66918860 CAGCCCAGTGAAGAAGGCCCAGG + Intronic
1084476488 11:69392307-69392329 GACCACAGGGGAGGAGGCAGAGG + Intergenic
1084497751 11:69514868-69514890 GAGCCCAGTGAGGAAGGCAGAGG + Intergenic
1084601246 11:70147206-70147228 CAGCACAGTGGAGGAGACATCGG + Intronic
1084705859 11:70815674-70815696 GAGCCCAGGCCAGGAGGCACTGG + Intronic
1084764720 11:71300824-71300846 TAGCCCAGGGAAGGAGGCAGGGG + Intergenic
1088457738 11:110050265-110050287 GAGCCCAGAGGAGGAGCAGCCGG - Intergenic
1088812772 11:113402648-113402670 GAGGGAAGTGGAGGAGGCACAGG + Intergenic
1089453235 11:118610902-118610924 CAGCCGAGTGGCGGAGGCCCAGG - Intronic
1089498861 11:118921545-118921567 CAGTCCATTGGAGGAGGAACGGG + Intronic
1090248822 11:125236806-125236828 GGGCCCAGTTGAGGAGGGAAGGG + Intronic
1090449269 11:126791705-126791727 GAGCCCAGTGAAAGAGGGAGAGG + Intronic
1091224943 11:133951493-133951515 GAGCCCAGCCGAGAAGGCTCAGG - Intronic
1091296303 11:134476151-134476173 CACCCCACTGGAGGAGGCAGGGG + Intergenic
1091395623 12:152729-152751 GAGCCCAGTGGGGCAGGGAGAGG + Intronic
1091635609 12:2194317-2194339 GAGCACAGAGGAGGAGGAACGGG - Intronic
1091823321 12:3492034-3492056 GAGCCCAGAGGAGAGGGCAGGGG - Intronic
1092456144 12:8644706-8644728 GAGCACAGTGGAGGAGAGGCAGG - Intronic
1094807482 12:34107163-34107185 CAGCGCATTGGGGGAGGCACAGG + Intergenic
1097184426 12:57188988-57189010 GACCCCAGTGGAGAGGGCAGGGG + Intronic
1101720672 12:107347938-107347960 GAGCCCAGAGATGGAGGAACAGG + Intronic
1102122395 12:110451785-110451807 GTGTCCAGTGGGGAAGGCACTGG + Intergenic
1102465873 12:113130621-113130643 GAGGCCACTGTAGGAGGCACAGG + Intronic
1102469320 12:113150637-113150659 GAGACCAGTGGTGGGGCCACGGG - Intronic
1102548763 12:113675485-113675507 GACTCCAGTGGAGGCGGCAGAGG - Intergenic
1102622015 12:114203595-114203617 AAGCCAAGGGGAGGAGGCAGAGG - Intergenic
1104603393 12:130169078-130169100 GAGCCCAAGGGAGGAGGCCGTGG + Intergenic
1104657652 12:130585531-130585553 GAGCCCAGTTGGGGAGGTCCTGG + Intronic
1104673381 12:130695722-130695744 GAGGCCAGGGGACGAGGCAGAGG + Intronic
1104740181 12:131166160-131166182 CAGGCCTGTGAAGGAGGCACTGG + Intergenic
1105544609 13:21342359-21342381 GAGCCCAGTAGAGAAGGCTGAGG - Intergenic
1106665226 13:31844991-31845013 GAGCTCAGTTAAAGAGGCACAGG - Intergenic
1108437518 13:50415241-50415263 TAGGCCAGTGGAGGAGACAGGGG - Intronic
1111091735 13:83454814-83454836 GAGCGCAGTGGAGGAGGGAATGG - Intergenic
1112357325 13:98684694-98684716 GAGGCAAGTGGAGGATGGACTGG - Exonic
1113744963 13:112737847-112737869 GAGGCCAGTTATGGAGGCACAGG - Intronic
1113913436 13:113855666-113855688 GAGCCCAGTGGGAGAGGCCGGGG - Intronic
1116845490 14:49861605-49861627 CAGCTCAGTGGAGGATGCAGAGG + Intergenic
1118767969 14:68922634-68922656 AAGGACAGTGGAGGAGGCAAGGG + Intronic
1119420514 14:74505437-74505459 AAGCGCAGGGGAGGAGGAACTGG - Intronic
1121060086 14:90899043-90899065 GAGCTCAGTGGTGCAGTCACTGG - Intronic
1121211815 14:92213011-92213033 GATCCCATTGGCGGTGGCACAGG + Intergenic
1121268588 14:92622251-92622273 GAGCCCACAGGAGGATGCTCTGG - Intronic
1121269488 14:92628431-92628453 GAGCCCACAGGAGGATGCTCTGG - Intronic
1121379392 14:93449564-93449586 GAGCGCAGTGGTGCAGTCACTGG - Intronic
1122112189 14:99510495-99510517 GAGGCTGGGGGAGGAGGCACAGG - Exonic
1122317742 14:100835796-100835818 AGGCCCACAGGAGGAGGCACTGG - Intergenic
1122707150 14:103628784-103628806 GAGCCCAGTGGTGGCGGCTGCGG + Intronic
1123041716 14:105492926-105492948 GAGCCCAGTGGGGTGGGCAATGG + Intronic
1202852779 14_GL000225v1_random:31425-31447 CAGCCCGGTGGAGGGGGCAGGGG - Intergenic
1202857998 14_GL000225v1_random:63558-63580 GAGCCCAGTGTAGGGGGCGGGGG + Intergenic
1124109608 15:26773397-26773419 GAGCCCAGAGGAGCCGGCTCAGG - Intronic
1125707145 15:41748654-41748676 GAGACCTGTGGAGTAGCCACTGG - Exonic
1128061026 15:64736212-64736234 GACACCAGTGGAGCATGCACTGG + Intergenic
1128140978 15:65301005-65301027 GGCCCCAGTGGAGGATCCACTGG - Intergenic
1128363857 15:66982873-66982895 AAGCCCAGTTGAGGGGTCACTGG - Intergenic
1128789728 15:70424075-70424097 CAGTTCAGTGGAGGATGCACAGG - Intergenic
1129034516 15:72641347-72641369 GAGCCCAAGGGAGGAGGCAGAGG + Intergenic
1129215366 15:74095869-74095891 GAGCCCAAGGGAGGAGGCAGAGG - Intergenic
1129226993 15:74175869-74175891 GAGCTCAGTGGACGTGGCACTGG + Exonic
1129383821 15:75184665-75184687 TAGCCCAGAGGAGGAGGTATTGG - Intergenic
1129546803 15:76404242-76404264 GATCTCAGTGGAAGAGGGACTGG + Intronic
1129732508 15:77940198-77940220 GAGCCCAAGGGAGGAGGCAGAGG - Intergenic
1129992066 15:79974038-79974060 GGGCACAGTCTAGGAGGCACGGG - Intergenic
1130882148 15:88064647-88064669 GACTGCAGTGGAGGGGGCACTGG - Intronic
1132697279 16:1207576-1207598 GAGCCCAGCGGAGTGGGCAGGGG + Intronic
1132819243 16:1854695-1854717 TAGCCCTGTGGAGAAGGCAAAGG - Intronic
1133116789 16:3582159-3582181 GAGCCCAGAGGAGGAAGCCCTGG + Exonic
1133980235 16:10627807-10627829 GAGGGCAGAGGAGAAGGCACAGG + Intronic
1134439838 16:14292722-14292744 AATCAAAGTGGAGGAGGCACTGG - Intergenic
1136418342 16:30116935-30116957 GATCACAGTGGAGGAAGCGCTGG - Exonic
1137308917 16:47233819-47233841 GAGCCCAGTTGATGAAGTACTGG - Intronic
1137624326 16:49898149-49898171 AAGCCCAGTGAAGGAGGCATGGG - Intergenic
1138442361 16:57042646-57042668 GAGCCCAGGGGAGAGGTCACAGG + Intronic
1139775880 16:69316855-69316877 GAGCCCTGCCGAGGTGGCACAGG + Intronic
1140432778 16:74919105-74919127 GGGACCAGCGGGGGAGGCACAGG - Intronic
1141172579 16:81700683-81700705 GAGCCCTGGGGAAGAGGCAGCGG + Intronic
1141555637 16:84835020-84835042 GAGCCCAGTGCTGGGTGCACAGG - Intronic
1141688169 16:85582058-85582080 GAGCCCAGGGATGGAGGCCCAGG - Intergenic
1142183344 16:88682295-88682317 GAGCACAGTAGAGTGGGCACTGG - Intronic
1142245734 16:88969335-88969357 GAGCCCAGTAGAGAAGGAACTGG - Intronic
1142374444 16:89699993-89700015 GAGCTCAGTGCTGCAGGCACTGG - Intronic
1144579085 17:16447874-16447896 ACTCCCAGTGGAGGCGGCACCGG - Exonic
1145233357 17:21190976-21190998 AAGCCCTGTGGAGGTGGCCCAGG + Exonic
1145905028 17:28511555-28511577 GACCCCAGGGGAGGAGGCAGGGG + Intronic
1146387897 17:32393869-32393891 CAGCCATGTGGAGAAGGCACAGG + Intergenic
1146558465 17:33847798-33847820 GAGCCCAGTGGAGGGGAGCCTGG + Intronic
1146654170 17:34625662-34625684 GAGCGCAGTGCAGGATACACAGG + Intronic
1147338530 17:39740674-39740696 GAGCGGAATGGGGGAGGCACGGG - Intronic
1147369090 17:39979476-39979498 GAGGACAGTTGAGGAGGAACTGG + Intergenic
1147602937 17:41757078-41757100 CAGCTCAGGGGAGGAGGCAGAGG + Intronic
1148328368 17:46797390-46797412 GGGCCAAGTGGAGGAGGGAAAGG + Intronic
1148773432 17:50079760-50079782 GGGACCAAAGGAGGAGGCACTGG + Intronic
1149602078 17:57899491-57899513 GAGCCCAGTGGCTGCAGCACTGG + Intronic
1149849586 17:60026875-60026897 GAGCCCCATGGAGCAGGCAAGGG + Intergenic
1149860582 17:60119649-60119671 GAGCCCCATGGAGCAGGCAAGGG - Intergenic
1150613752 17:66753367-66753389 GTGGCCAGTGGAGGAGTCAGTGG + Intronic
1150654608 17:67031653-67031675 GTGGCCTGTGGAGGAGGCCCAGG + Exonic
1150715555 17:67569950-67569972 GAGCCCAGAGGAGGAAGAAGAGG + Intronic
1151225959 17:72648646-72648668 GAGCACAGTTGAGGAGGCAGTGG + Intronic
1152261708 17:79270716-79270738 AGGCCCAGTGGAGGAGGAACAGG - Intronic
1152310611 17:79547719-79547741 GAGACCAGTGGAGCAGGCTGGGG + Intergenic
1152361834 17:79836450-79836472 AAGCCCATGGGCGGAGGCACCGG + Intronic
1152775896 17:82201803-82201825 GAGCCAGCTGGAGGAGGCGCAGG - Exonic
1152802854 17:82339951-82339973 GAGGACACTGGGGGAGGCACTGG - Intergenic
1153389354 18:4536474-4536496 TAGCTCAGTTGAGCAGGCACTGG + Intergenic
1153752317 18:8245344-8245366 TGGCCCAGTGGAGCATGCACAGG + Intronic
1155428166 18:25727564-25727586 GAGCCAAGTGCAGGAGACACAGG + Intergenic
1156735743 18:40256866-40256888 CAGCACAGTGGAGGTGGAACAGG + Intergenic
1157522143 18:48352602-48352624 GAGCAGGCTGGAGGAGGCACTGG + Intronic
1159214129 18:65367551-65367573 TAGCCAAGTGGAGGAGTCAATGG - Intergenic
1160258529 18:77267814-77267836 GTGGCCAGTGGAGGAGGCCATGG + Intronic
1160282171 18:77501439-77501461 GAGCTCAGTGGAGCAGCCACAGG - Intergenic
1161755534 19:6130875-6130897 GGCACCAGTGGAGGACGCACAGG + Intronic
1161776139 19:6263286-6263308 GTCCCCAGCAGAGGAGGCACGGG + Intronic
1162455658 19:10782898-10782920 GAGCCAAGTGGACCTGGCACGGG - Intronic
1162829260 19:13274428-13274450 GAGCCTAGAGGCAGAGGCACAGG + Intronic
1162948518 19:14057502-14057524 GAGCCCCGCGGAGGAGGGAGGGG - Intronic
1163290797 19:16377852-16377874 GAGCCCAGTGGAGGTGGCGTGGG - Intronic
1163713303 19:18859853-18859875 GAGCCCAGAGGCAGAGCCACCGG + Intronic
1163833945 19:19562244-19562266 CAGCTCAGTGGAGGAGGGAAGGG + Intronic
1164280646 19:23765626-23765648 GAGCCTATTGGAGGAGGGAGAGG + Intronic
1165145728 19:33728799-33728821 GAGCCCAGGGCAGGAGGAGCTGG + Intronic
1165350643 19:35273283-35273305 GAGGCCAGTGGATGTGGCAATGG - Intronic
1166000572 19:39875293-39875315 GAGCCCCATGGAGGAGGAAGGGG + Intronic
1166003370 19:39891548-39891570 GAGCCCCATGGAGGAGGAAGGGG + Intronic
1166306190 19:41938286-41938308 GAGCCTAATGGAGGAGGGGCTGG - Intergenic
1166788270 19:45382502-45382524 GAGCCCAGGGGAGAAGTCATGGG - Intronic
1166855651 19:45781606-45781628 GATCGCAGAGGAGGGGGCACTGG + Intronic
1167281623 19:48572631-48572653 GAGGCCAGAGGAGGAGGCACTGG + Intronic
1167445540 19:49535032-49535054 GAGCCCTGTGGAGGACAGACTGG - Intronic
1167688011 19:50968667-50968689 GAGCCAAGCGGAGGACGCAGGGG + Exonic
1168297589 19:55384933-55384955 GAGCCCTGGGGAGGTGACACAGG + Intergenic
1168469272 19:56627652-56627674 GAGCCCAGTTGGGGAGGTGCTGG + Intergenic
925886765 2:8400429-8400451 GGGCCGAGTGGAGAAGGCAGGGG - Intergenic
926314181 2:11697378-11697400 GTGGCCAGTGCAGGAGGAACAGG + Intronic
926685764 2:15696709-15696731 GAGCCCAGTGGATCCTGCACTGG + Intronic
926685768 2:15696713-15696735 GACCCCAGTGCAGGATCCACTGG - Intronic
926742736 2:16125936-16125958 GGTCCCTGTGGTGGAGGCACAGG - Intergenic
926767256 2:16332891-16332913 GAGCCCTGTGGGTGAGCCACAGG + Intergenic
927000962 2:18793790-18793812 GAGGCCAGGGTAGGAGGCCCTGG + Intergenic
927504603 2:23604794-23604816 GAGCAGGGAGGAGGAGGCACTGG - Intronic
927826729 2:26314487-26314509 GAAGCCAGGGGAGGTGGCACAGG + Exonic
928838384 2:35575445-35575467 GATCCCACTGCTGGAGGCACTGG + Intergenic
929603271 2:43218165-43218187 GAGCGCACTGGAGGGGACACAGG + Intergenic
929928065 2:46231506-46231528 GAGGCCAGGTGAGGATGCACAGG + Intergenic
929951079 2:46409981-46410003 GAGCCCAGATGAGGAGGCTGTGG - Intergenic
929957498 2:46469891-46469913 GAGCTCAGTGGAGGAGGCGGAGG - Intronic
930879952 2:56259409-56259431 GAGCCCAGCGAGGGAGGCACTGG - Intronic
932082388 2:68726796-68726818 GAGCCCAGTGGATGGGGTGCAGG - Intronic
932429781 2:71667404-71667426 GGGCCCAGTGGAGGAGCGTCTGG + Exonic
933918337 2:87019050-87019072 GAGAGCAGTGGAGGCGGCAGCGG + Intronic
934004659 2:87750863-87750885 GAGAGCAGTGGAGGCGGCAGCGG - Intronic
934026178 2:88003272-88003294 GAGGCCTGAGGAGGAGGCACGGG - Intergenic
934227978 2:90150378-90150400 GATCCCAGGGGAGGAGGTCCTGG + Intergenic
934769500 2:96898939-96898961 AAGCCCCGTGGAGGAGACATTGG + Intronic
935204120 2:100882878-100882900 TAGCCCAGCCGAGGAGGAACAGG - Intronic
935220069 2:101004592-101004614 GAGCCCAGTGGAGGAGGGAGGGG + Intronic
935620769 2:105127719-105127741 CTGCCCAGTGCAGGAAGCACAGG - Intergenic
936934563 2:117826759-117826781 GAGGGCAGGGGAGGAGGCAGAGG - Intronic
937053553 2:118912111-118912133 GGACCCAGTGGAAGTGGCACAGG + Intergenic
937090271 2:119201552-119201574 GAGCCCAGTGATGGGTGCACAGG + Intergenic
937333168 2:121044649-121044671 GGCCCCGGTGAAGGAGGCACTGG + Intergenic
938301136 2:130213733-130213755 GCGCCCAGTGGCGGGGGCAGCGG - Intergenic
938644322 2:133315657-133315679 GAGGCCAGTGAGGGAGGAACAGG + Intronic
939509551 2:143089536-143089558 GACCCCAGTGCAGGATCCACTGG - Intergenic
942299569 2:174548685-174548707 GAGGCCGGTGGGGGAGGCTCAGG + Intergenic
943646293 2:190409930-190409952 GAGCCCAGTGCAGGATGCTCTGG + Intronic
943952420 2:194147368-194147390 GAGCCCAGAGGATTTGGCACAGG - Intergenic
946395554 2:219442165-219442187 GGGCCCGGTGGAGGGGGCGCTGG + Intronic
947252003 2:228117373-228117395 AAGCCCATTGGAAGAGGCATGGG + Intronic
947330814 2:229027573-229027595 GTGTTCAGTGGAGGAGGCAGTGG + Intronic
947665271 2:231901339-231901361 GAAGCCAGGGGAGGAGGCACTGG - Intergenic
948115656 2:235493320-235493342 GAACCCCGTGGAGCAGGCAGCGG + Intergenic
948808928 2:240465244-240465266 CAGCCCAATGGAGGCGGCATGGG - Intronic
948811705 2:240481737-240481759 GAGGCCAGTGGTGGAGGGAGGGG + Intronic
1169020353 20:2326403-2326425 GAGGCCAGAGGAGGAAGCAGAGG - Intronic
1169564460 20:6838520-6838542 AAGCCCTGTAGAGGAGGCCCTGG + Intergenic
1170404325 20:16020266-16020288 AAGCCCAGAGCAGAAGGCACAGG - Intronic
1170571982 20:17637684-17637706 GAACCCTGAGGAGGAGCCACTGG + Intronic
1170603598 20:17859872-17859894 GAGCCCAGGGGAGTTGGCAGTGG + Intergenic
1172302320 20:33858824-33858846 GAGCTCAGTGGGGCAGACACAGG + Intergenic
1172657016 20:36543512-36543534 CAGCCGAGGGAAGGAGGCACTGG + Intronic
1173202019 20:40961321-40961343 GAGCCCAGTTGAGGTGGCAATGG - Intergenic
1173384413 20:42574612-42574634 CAGCCCACTGGAGCAGGCTCGGG + Intronic
1173718191 20:45229858-45229880 GGGCCATGTGGAGGAGGCAAAGG - Intergenic
1174445850 20:50590601-50590623 GAGCCCTGTGTAGGAGGAGCGGG - Intronic
1175328722 20:58148088-58148110 GAGCCCAGAGGAGCAGTCCCTGG + Intergenic
1175345095 20:58267372-58267394 GAGCCCAGAGGTAGAGGCAGTGG + Intergenic
1175759813 20:61554334-61554356 GGGGGCAGTAGAGGAGGCACAGG + Intronic
1175920042 20:62446420-62446442 GAGCACAGAGAAGGAGGGACAGG - Intergenic
1175966085 20:62660904-62660926 CAGCCCCGGGGAGGCGGCACTGG - Intronic
1176021089 20:62962798-62962820 GCCACCAGGGGAGGAGGCACTGG - Intronic
1176172856 20:63703966-63703988 GACCCCAGTGGAGCAGTCAGAGG + Intronic
1176284340 21:5011586-5011608 GAGCCCAGAGGAGAAAGCTCCGG - Intergenic
1178488138 21:33031714-33031736 GAGGCCAGAGGAGGAGGCTCGGG - Intergenic
1178582460 21:33848099-33848121 AAGTCCAGTCGAGGAGGCGCTGG - Intronic
1178586817 21:33877590-33877612 GAACCCAGAGGAGGAGTGACAGG - Intronic
1178853664 21:36233355-36233377 GAGTGCAGTGGAGGAGTCATGGG - Intronic
1178857873 21:36265448-36265470 AAGGCCAAAGGAGGAGGCACTGG - Intronic
1179872841 21:44251889-44251911 GAGCCCAGAGGAGAAAGCTCCGG + Intronic
1179887130 21:44318991-44319013 GACCCCAGGAGAGGAGGTACGGG + Intronic
1180074646 21:45456363-45456385 GAGCCCAGAGGAGAAGGCGGAGG - Intronic
1180867344 22:19127083-19127105 GAGGCCAGGGGAGGATGCACTGG - Intergenic
1180875806 22:19174828-19174850 GAGCCACGTGGAGGACGCTCAGG - Intergenic
1180953565 22:19731432-19731454 GGGCCCCGTGGAGGAGGTCCTGG + Intergenic
1181634829 22:24169685-24169707 TGGGCCAGTGGAGGAGGCAGGGG - Intronic
1181969891 22:26681916-26681938 GAGCCAACTGGAGGTGGGACAGG + Intergenic
1182058844 22:27382334-27382356 GAGGCCAGTGGGGAAGGCTCTGG + Intergenic
1183253602 22:36746699-36746721 CAGCCCAGCCGAGGAGGCCCTGG + Intergenic
1183263344 22:36810536-36810558 GAGCTCAATGGAGGCTGCACAGG + Intronic
1183749745 22:39713092-39713114 GAGCCCAGAGGAGGGGGGAGAGG + Intergenic
1184071712 22:42151108-42151130 GGGCCCAGTGCAGGGGGCAAGGG - Intergenic
1184152294 22:42646177-42646199 CAGCACAGGTGAGGAGGCACAGG - Intronic
1184192400 22:42903561-42903583 GAGCCCAGTGGTGGATGAGCTGG - Intronic
1184433845 22:44458251-44458273 GGGCCCAGAGGAGGTGGCACAGG - Intergenic
1184764557 22:46564685-46564707 GAGGCCAGCGGAGGTGACACAGG + Intergenic
1184826140 22:46952662-46952684 GAGTCCAGTGCTGGAGGCAGAGG + Intronic
1184894533 22:47399477-47399499 GGGGCCAGTGGAGGGGGCAGTGG - Intergenic
1184981320 22:48097617-48097639 GAGCACACAGGAGAAGGCACCGG + Intergenic
949611976 3:5712087-5712109 CAGCCAAGTGGAGGAAGCACTGG - Intergenic
949926063 3:9042821-9042843 GAACCCAGAGGAGGGGGAACAGG - Intronic
950146591 3:10654480-10654502 GAGCGAAGTGGAGGAGACATAGG + Intronic
950612143 3:14133557-14133579 CAGCCCAGGGGAGGGGGCACAGG + Intronic
951299435 3:20975684-20975706 GAGCCCAGTGGAGAATTCACAGG - Intergenic
953708955 3:45253340-45253362 GAGGCCAGTGGAGAAGGGAGAGG + Intergenic
953793576 3:45966555-45966577 GGAGCGAGTGGAGGAGGCACTGG - Exonic
954146770 3:48638325-48638347 GAGAGCAGTGGTGGAGGCAAGGG - Intronic
954535407 3:51355954-51355976 CAGCCCAGTAGGGGAGGCAGTGG - Intronic
954634330 3:52063408-52063430 GAGGCCTGGAGAGGAGGCACGGG - Intergenic
956304232 3:67806126-67806148 GAACCCAGTGGAGGGCTCACAGG - Intergenic
958622264 3:96576394-96576416 GGGCCCAGTGGGGTAGGCACCGG + Intergenic
959133785 3:102391575-102391597 CAACCCCGTGGAGGAGCCACTGG + Intronic
961047961 3:123722276-123722298 CTGCCCTGTGGAGGAAGCACAGG + Exonic
961269998 3:125681288-125681310 CTGCCCTGTGGAGGAAGCACAGG - Intergenic
961826605 3:129602431-129602453 GAGCCCAGCGGAGGGGGCGGAGG - Intronic
962119919 3:132550517-132550539 GATGCCTGTGGAGGATGCACAGG - Intergenic
962385207 3:134927260-134927282 GAAACCAGTGGAGAATGCACAGG - Intronic
963175896 3:142297613-142297635 GAGCCTAGTAGAGGAGGGATGGG - Intergenic
963296890 3:143556436-143556458 GAACCCAGTGGAGGAGAGAAGGG + Intronic
964490185 3:157227862-157227884 GAGGCCAGAGGAGAAGGTACTGG - Intergenic
966516886 3:180829201-180829223 AAGCCGAGTGGAGGAGCCGCTGG - Intronic
966926848 3:184649982-184650004 GAGCCATGGGGAGGAGGCACAGG + Intronic
967857909 3:194132235-194132257 GAGCCTAGCAGAGCAGGCACTGG + Intergenic
968080081 3:195839859-195839881 GAGCCCAGTGGTGGACGAAAGGG + Intergenic
968905020 4:3447005-3447027 GAGCCCAGGGCAGGAGGCCGAGG + Intronic
968936526 4:3614012-3614034 GAGCCCAGGGGCAGAGTCACTGG - Intergenic
968941869 4:3643218-3643240 GAGCCTAGAGGAGGAGGAAGAGG - Intergenic
969480747 4:7445638-7445660 GAGGCCAGAGGAGGAGGCAAGGG + Intronic
970559130 4:17265832-17265854 GATTCTAGTGGAGGAGGCAAAGG - Intergenic
972526836 4:39922057-39922079 GAGCCCAGTGGTGGAGCCTGAGG + Intronic
973995912 4:56458329-56458351 GAGTCCTGGGCAGGAGGCACAGG + Intronic
974039439 4:56845185-56845207 GAGCACAGCAGAGGAGGCATTGG - Intergenic
977937806 4:102826916-102826938 GAGCCCAGCAGAGGAGGAGCCGG + Intronic
979288215 4:118950620-118950642 GAGCCAGGTAGAGGAGGCAGTGG + Intronic
979380959 4:120006117-120006139 GAGCACAGTGAAGGAGGAGCAGG + Intergenic
979445611 4:120808549-120808571 GACCCCAGTGTAGGATCCACTGG - Intronic
981072779 4:140561942-140561964 GGGACCAGTGGAAAAGGCACTGG + Intronic
982209063 4:153020405-153020427 GAGCCTAGTGGAACAGCCACTGG + Intergenic
985651560 5:1110020-1110042 GAGCCTGGGGAAGGAGGCACAGG - Intronic
985763198 5:1762436-1762458 GCGCTGAGTGGAGGAGGCAGAGG + Intergenic
985884027 5:2662440-2662462 GAGTCCAGTGGAGGTGGCAGAGG - Intergenic
986000020 5:3623061-3623083 GAGCCCACGGGAGCAGGCTCTGG + Intergenic
986166152 5:5273063-5273085 GAGCCCAGTGGGGTGGACACGGG + Intronic
986277815 5:6295466-6295488 GAGGCAAGTGGAAAAGGCACTGG + Intergenic
986327148 5:6684873-6684895 GAACACAGTGGAGCAGGCACCGG - Intergenic
986722715 5:10571481-10571503 GAGGCCAGGGGCGGTGGCACAGG - Intronic
987069559 5:14322977-14322999 GAGCACAGAGGAGGTGGGACTGG + Intronic
991312056 5:65254535-65254557 GAGGCCAGTGTAGGAAGAACAGG + Intronic
991568889 5:68034023-68034045 GAACGCACTGGAGGAGGCACTGG - Intergenic
997428572 5:133821663-133821685 GGGCACTGTGGAGGAGGCGCAGG + Intergenic
997454324 5:134005879-134005901 GGGCCCTGTGGAGGAGGTGCCGG + Intergenic
997599595 5:135130264-135130286 GAGACCAGAGCAGGAGGCAGGGG - Intronic
997618483 5:135269850-135269872 GAGCCCAGTGTAAGAGGTCCTGG + Intronic
997646819 5:135487460-135487482 GACCCCAGTAAAGGTGGCACTGG + Intergenic
997694249 5:135849182-135849204 TAGACAAGTGGAGGAGGCCCTGG - Intronic
998567529 5:143229572-143229594 GGGCTCAGTGGAGGCGGCATGGG + Intergenic
999062885 5:148654376-148654398 GCGCCCAGTGGGGGCGGCAGCGG - Intronic
999199510 5:149805910-149805932 GAGCCCAGTGTGGGAACCACAGG + Intronic
1000125524 5:158239954-158239976 GAGCTTAGTGAAGGAGTCACTGG + Intergenic
1000295050 5:159906171-159906193 GAGCCCAGTGGAGGCAAGACTGG + Intergenic
1001134376 5:169090310-169090332 GAGACTGGTGGTGGAGGCACTGG - Intronic
1001495864 5:172187612-172187634 GAGCGCAGTGCAGGACACACAGG + Intronic
1002451499 5:179321547-179321569 CAGACAAGTGGAGGAGGCAGTGG - Intronic
1003995649 6:11537659-11537681 GAGCGCAGGGGAGGAGGGGCCGG + Intergenic
1004043995 6:12009281-12009303 GGGCCCAGTGGACGCGGCTCCGG + Intronic
1004701796 6:18086585-18086607 AAGCCCAGTGTTGGAGGCAAGGG + Intergenic
1005997868 6:30942497-30942519 GAGGCCAGGGGTGGAGGCAGGGG + Intronic
1006428740 6:33982400-33982422 GAGCCACATGGAGGAGGCAAGGG + Intergenic
1007777892 6:44233965-44233987 GAACACAGAGGAGGAGGCGCAGG - Exonic
1010069678 6:71728883-71728905 GAACCCAGGAGAGGAGGCAGAGG - Intergenic
1010395711 6:75389843-75389865 GAGCACAGTGGAAGAGTCTCAGG - Intronic
1011725366 6:90205364-90205386 AAGCCCAGAGAAGGAGGCAAGGG - Intronic
1013690580 6:112637458-112637480 GAGAACAGTGGAGGAGGAAGAGG - Intergenic
1013964159 6:115935369-115935391 GGCCCCAGTGGCGTAGGCACCGG - Exonic
1014404672 6:121036488-121036510 CAGGCCAGTGGCGCAGGCACAGG - Intergenic
1015291023 6:131538582-131538604 GACCCTGGTGGTGGAGGCACCGG - Intergenic
1017760670 6:157565726-157565748 GAACCCAGTGCAGGAGGCGGAGG + Intronic
1018457066 6:163962158-163962180 CAGCCCAGGTGAGGAGGAACTGG + Intergenic
1018723273 6:166590014-166590036 GTGCTCAGAGGAGGAGGCAAGGG + Intronic
1018823569 6:167392943-167392965 GGGCGCAGGTGAGGAGGCACAGG - Intergenic
1018823614 6:167393109-167393131 GGGCGCAGGTGAGGAGGCACAGG - Intergenic
1018978484 6:168583352-168583374 GAGCCCAGTGGAGCTGGGAAGGG - Intronic
1020423224 7:8034683-8034705 GAGTCCAGTGGAGAACTCACAGG + Intronic
1020977119 7:15020463-15020485 AAGCCCTATGGAAGAGGCACAGG - Intergenic
1021783806 7:24133155-24133177 GTACCCAGGGGAGGAGGCAGGGG + Intergenic
1022171680 7:27837642-27837664 GGTCCCAGAGGTGGAGGCACTGG + Intronic
1022494225 7:30843273-30843295 GAGAGGAGTGGAGGAGTCACTGG + Intronic
1023267061 7:38417824-38417846 GGAGCCAGTGGAGGAGGCAGTGG - Exonic
1024010077 7:45259672-45259694 CAAGCCAGTGGAGGTGGCACAGG - Intergenic
1024455506 7:49601279-49601301 GAGACCAGTCTAGGAAGCACAGG - Intergenic
1024732190 7:52264971-52264993 GAGCCCAGCGGAGGGGTGACTGG - Intergenic
1024837094 7:53534133-53534155 CAGCCCAGTGGAGGGGGATCGGG + Intergenic
1025026391 7:55519803-55519825 GAGCCCAGTGTAGGAGGGAAGGG - Intronic
1025991919 7:66503481-66503503 GACCCCCGTGGAGGGGGCAGGGG - Intergenic
1026736313 7:72950915-72950937 GAGCCCAGTGGAGGAGGCACGGG + Exonic
1026786668 7:73305969-73305991 GAGCCCAGTGGAGGAGGCACGGG + Intronic
1027107420 7:75414147-75414169 GAGCCCAGTGGAGGAGGCACGGG - Intergenic
1027539593 7:79452297-79452319 CAGCCCGGGGGAGGAGGCTCCGG - Intronic
1029647630 7:101868371-101868393 CAGCCCAGGGGAGGAGGCGCTGG - Intronic
1035006641 7:155667684-155667706 GTGCCCACTTCAGGAGGCACAGG + Intronic
1035071622 7:156149023-156149045 GAGCCCAGTGAAGGGGGCACAGG - Intergenic
1035741121 8:1929549-1929571 GAGCGCAGGGGCGGAGGCACAGG - Intronic
1036565154 8:9932281-9932303 GACTCCAGGGGAGGAGGCGCTGG - Intergenic
1037784314 8:21893455-21893477 GAGCCCAGTGGAGCGGGCTGTGG - Intergenic
1037818766 8:22125535-22125557 GAGCCCTGGCGAGGGGGCACTGG + Intronic
1038226702 8:25664257-25664279 GAGCCCACTGAAGGGTGCACAGG + Intergenic
1038554097 8:28494476-28494498 GATCCCTGAGGAGGAGGCGCCGG - Intronic
1038670288 8:29577557-29577579 GAGCCCAGTGAGTGAGGCAGAGG - Intergenic
1039465633 8:37783382-37783404 GAGCCCAGTGGGGAAGGTTCTGG + Intergenic
1040580084 8:48690517-48690539 CAGCCCAGTGGAGCAGGGAAGGG - Intergenic
1041640694 8:60197601-60197623 GAGCACAGTGGAGATGGCTCAGG - Intronic
1042858988 8:73294845-73294867 GTGCGCAGCGGAGGCGGCACGGG - Exonic
1044533556 8:93334811-93334833 GAGGCCAAATGAGGAGGCACAGG - Intergenic
1047443363 8:124899042-124899064 GAGGCCACTGCAAGAGGCACTGG - Intergenic
1049388791 8:142357689-142357711 GAGCCCAGAGGGGCTGGCACAGG + Intronic
1049510643 8:143025117-143025139 GAGCCCAGAGGAAGGGGCTCAGG + Intergenic
1049663367 8:143830487-143830509 CAGCCCAGGGGTGGAGGCAGGGG - Intergenic
1049715202 8:144086568-144086590 GAGCCCTGCAGAGGAGGCCCAGG + Intergenic
1052817689 9:33114267-33114289 GAGCCCAGTTGAGGATGAACAGG + Intronic
1053064367 9:35057163-35057185 CAGGGCAGTGGAGGCGGCACAGG - Exonic
1053155499 9:35775516-35775538 GAGCTCAGTCAGGGAGGCACTGG - Intergenic
1053225407 9:36351167-36351189 GGGCCCACTGCAGGTGGCACTGG + Exonic
1053389705 9:37725626-37725648 AAGCCCAGAGGAGGAAGCAATGG + Intronic
1054717037 9:68566958-68566980 TAGCCCAGCTGAGGAGGCAAAGG - Intergenic
1054947724 9:70813722-70813744 GAGCACAGTGGTTGAGGCATGGG + Intronic
1056765355 9:89441636-89441658 GAGCCCTGAGGAGGAGCCATGGG - Intronic
1057300774 9:93880331-93880353 GACCCCAGTGCAGGATCCACTGG + Intergenic
1058647622 9:107145324-107145346 GAGCAAAGTGAAGGAGGCAGAGG + Intergenic
1059326111 9:113504947-113504969 GAGCACAGGGGAGGAAACACTGG - Intronic
1059814358 9:117894878-117894900 AAGCCCAGAGGAGAAGGCAAGGG - Intergenic
1060154607 9:121310638-121310660 TAGCCCAGGGGAGAAGGCCCAGG - Intronic
1060214121 9:121728136-121728158 GATCCCAGGGCAGGAGGCCCTGG + Intronic
1060802258 9:126552127-126552149 GTGCCCAGTGGAGAAGAGACAGG - Intergenic
1061160414 9:128890694-128890716 GATCCCAGGGGAGTGGGCACTGG - Intronic
1061162452 9:128903039-128903061 GAGCCCGGTGGTAGAGGGACAGG + Intronic
1061194572 9:129100759-129100781 GAGCCCAGGGCAGGAGGCTGCGG - Intronic
1061727450 9:132589537-132589559 GAGCCCGCGGGAGGAGGCCCCGG - Exonic
1062374608 9:136256242-136256264 GAGCCCCGTGGAGGAGTCCCAGG - Intergenic
1062380087 9:136282891-136282913 GCACTCAGTGGTGGAGGCACTGG - Intronic
1185609803 X:1387536-1387558 CAGCCACGTGGAGGGGGCACTGG - Intronic
1189157180 X:38770332-38770354 GAGCCCTGTGGAGGTGACACTGG + Intergenic
1190066114 X:47242814-47242836 GTGCCCAGTGAACGAGGCAGAGG - Intronic
1190759491 X:53427810-53427832 GAGGCCAGAGAAGGAGGCAGAGG + Intronic
1192795458 X:74421509-74421531 GAGCCTGGAGGAGGAGGCAGCGG + Exonic
1195162269 X:102182340-102182362 GATCCCAGAGGAGGAGGTTCAGG - Intergenic
1195166305 X:102223940-102223962 GATCCCAGAGGAGGAGGTTCAGG - Exonic
1195192555 X:102463148-102463170 GATCCCAGAGGAGGAGGTTCAGG + Exonic
1195463526 X:105154674-105154696 GGATCCAGTGGAGGAGACACAGG - Intronic
1199864101 X:151827591-151827613 GAGGCCAGGGAAGGAGGCAAGGG - Intergenic
1201166932 Y:11217083-11217105 GAGCCCAGGAGAGAAGGCTCAGG + Intergenic