ID: 1026787150

View in Genome Browser
Species Human (GRCh38)
Location 7:73308835-73308857
Sequence CGGCGCCCGCCCGGACTTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026787141_1026787150 17 Left 1026787141 7:73308795-73308817 CCGCGCGCCTTTACGGCTCTGTG 0: 1
1: 2
2: 0
3: 1
4: 35
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103
1026787137_1026787150 26 Left 1026787137 7:73308786-73308808 CCCATGTTCCCGCGCGCCTTTAC 0: 3
1: 0
2: 0
3: 0
4: 17
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103
1026787140_1026787150 18 Left 1026787140 7:73308794-73308816 CCCGCGCGCCTTTACGGCTCTGT 0: 3
1: 0
2: 0
3: 2
4: 20
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103
1026787143_1026787150 10 Left 1026787143 7:73308802-73308824 CCTTTACGGCTCTGTGGCAAAAC 0: 1
1: 0
2: 2
3: 2
4: 51
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103
1026787136_1026787150 27 Left 1026787136 7:73308785-73308807 CCCCATGTTCCCGCGCGCCTTTA 0: 3
1: 0
2: 0
3: 0
4: 28
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103
1026787138_1026787150 25 Left 1026787138 7:73308787-73308809 CCATGTTCCCGCGCGCCTTTACG 0: 3
1: 0
2: 0
3: 0
4: 9
Right 1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG 0: 1
1: 0
2: 3
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026787150 Original CRISPR CGGCGCCCGCCCGGACTTCC GGG Intronic
900091880 1:924256-924278 CGCCGCCCGCCAGGCCTCCCCGG - Intergenic
900221424 1:1511531-1511553 CGGCGCCTGCCCGGGCACCCCGG + Intergenic
903522342 1:23960084-23960106 CCGCGCCCGCCCGGGTTACCCGG - Intronic
905732085 1:40304354-40304376 CAGGGCCCCCCCGGAATTCCAGG - Exonic
905733716 1:40312590-40312612 CAGGGCCAGCCCGGGCTTCCTGG - Exonic
906225606 1:44119007-44119029 CTGGGCCCGCCCGGCCTGCCAGG - Intronic
906680987 1:47725356-47725378 CGGCGCCCGCCCGGGGCACCCGG + Intergenic
907501821 1:54886776-54886798 CGGGGGCGGCCAGGACTTCCTGG - Intronic
914842126 1:151257037-151257059 CTGTGCCCGGCCGGTCTTCCAGG + Intronic
916037202 1:160932792-160932814 CGGCGCGCGCCCGCAATCCCAGG - Intergenic
917533941 1:175861100-175861122 CGGCTCCAGACCTGACTTCCAGG - Intergenic
922565145 1:226596833-226596855 CGGGGCCCGCACCGACCTCCCGG + Exonic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1069849535 10:71396434-71396456 GCTCGCCCGCCCGGGCTTCCCGG + Intergenic
1071538208 10:86454508-86454530 CGGCGCCCGCCTGCAGTCCCAGG - Intronic
1072540595 10:96395328-96395350 TGGGGCCATCCCGGACTTCCAGG + Exonic
1072784062 10:98268393-98268415 CCCCGCCCCCCGGGACTTCCCGG - Intergenic
1076096439 10:127737504-127737526 CGGCGCCCGCCAGGCCGCCCGGG - Exonic
1077121493 11:910929-910951 CGGCCCCGGCCCCGACTTTCGGG - Intronic
1080639157 11:34148779-34148801 CGGAGTCCTCCGGGACTTCCGGG - Intergenic
1083766727 11:64844852-64844874 CGGCCCGCCCCCGCACTTCCTGG - Intergenic
1084074468 11:66762312-66762334 CGGGGCCCGCCCCGCCTTTCCGG - Intronic
1084184565 11:67464787-67464809 CGGTGCCCGCTCGCACCTCCAGG + Exonic
1085822071 11:79804144-79804166 CGGCGCACGCCCGCAATCCCAGG - Intergenic
1088893136 11:114059922-114059944 CGCCGCGCGCCGGGGCTTCCCGG + Intronic
1090086530 11:123654870-123654892 CCGCTCCCGCACGGACTTGCCGG + Intronic
1096856810 12:54489108-54489130 CGGCGCGCGCCCGCAATTGCAGG + Intergenic
1103649659 12:122422712-122422734 CCGCGCCCGCCCGGCCGGCCCGG + Intergenic
1103852229 12:123940769-123940791 CTGGGCCCGCCCAGACTTCTGGG + Intronic
1107133582 13:36920543-36920565 CGGCCCCTGCCCGGCCTGCCGGG + Intronic
1108350245 13:49585289-49585311 CAGCGCCCGCAGGGACTGCCCGG + Intronic
1109007733 13:56900783-56900805 CGGGGCCCGCCCGGAGTGCGGGG - Intergenic
1118350918 14:64972094-64972116 CGCTGCCCGCCCGCAGTTCCCGG - Exonic
1121437355 14:93928445-93928467 CGGCTCCCGCGGGGCCTTCCTGG + Exonic
1122628835 14:103098217-103098239 CGGCGCTCGTCTGGGCTTCCTGG + Intergenic
1122876409 14:104668024-104668046 CGGCACCCGGCCGGAAGTCCAGG - Intergenic
1202847985 14_GL000009v2_random:199559-199581 CGGCGCACGCCCGCAATTGCAGG - Intergenic
1128318118 15:66673796-66673818 CTGCGCCAGCCCCGCCTTCCCGG + Intronic
1132465785 16:76914-76936 GGGCCCCAGCCAGGACTTCCTGG - Intergenic
1133287773 16:4698488-4698510 CCGCGCCCGCGAGGACCTCCAGG - Exonic
1142193406 16:88728249-88728271 CGGCCCCCGGCCACACTTCCTGG + Intronic
1142379207 16:89722033-89722055 CGTCGCCGGCCCGGCCTCCCCGG + Intronic
1143590854 17:7885232-7885254 CACCGCCCGCCCCGACCTCCCGG - Intronic
1147183636 17:38702298-38702320 CCGCGCCGGCCCGCACCTCCCGG - Intergenic
1148157205 17:45431220-45431242 CCGCTCCCGCCCGGGCTTCGGGG + Intronic
1150108287 17:62478212-62478234 CGGACCCCGCCCGGACTTCCCGG - Intronic
1150558441 17:66274729-66274751 CGGCTGCAGCCTGGACTTCCTGG + Intergenic
1151780105 17:76240133-76240155 CGGCGCCCGCCCGCCCTCACCGG + Exonic
1152654914 17:81514911-81514933 GGGCGCCCGCCCGGCGCTCCTGG + Intronic
1158579674 18:58671068-58671090 CGGCTCCCGCCCGCAGTCCCCGG - Intergenic
1161001402 19:1912866-1912888 CGGCGCCTGCGCGGACGGCCTGG - Exonic
1161210217 19:3062040-3062062 CGGCGCCCCCCCCAACTCCCCGG - Intronic
1162802339 19:13118414-13118436 CGGAGCCCGCCGGGACCCCCCGG + Exonic
1162962597 19:14136701-14136723 CGGCGCGCGCCCAGACTCCTCGG + Exonic
1163111127 19:15161406-15161428 CGGCCCCAGCCCCGCCTTCCCGG + Exonic
1163118372 19:15201068-15201090 CGCCCCCCGCCCGGCCTCCCGGG + Intergenic
1163729564 19:18941256-18941278 CGCCGCCCGCCCCGCCTCCCCGG + Intronic
1165448221 19:35868478-35868500 CCGCGCCGGCCCCGCCTTCCTGG - Exonic
1168153860 19:54462728-54462750 CGGAGCCCCCCGGGACTCCCAGG + Exonic
1168247293 19:55118851-55118873 CTGCGCCCACCCGGACCTCCTGG + Intergenic
925369070 2:3330044-3330066 CGGCACCAGCCTGGGCTTCCTGG + Intronic
929448034 2:42015472-42015494 CGGCGCGCGCCCGCAATTGCAGG + Intergenic
932152713 2:69387421-69387443 CCGCGTCCGCCTGGAGTTCCTGG + Intergenic
933869301 2:86550241-86550263 CGGCGCACGCCCGCAATCCCAGG + Intronic
936104782 2:109614639-109614661 CCGCGCCCGCGCGCACTTCAAGG + Exonic
941917124 2:170820221-170820243 CGGCGCCCTTACGGAATTCCCGG + Intronic
943418661 2:187638006-187638028 CGGCGCCCGCCCGCAATCCCAGG + Intergenic
1169044395 20:2524562-2524584 GGGCGCCCGCCCGAACCGCCAGG + Intronic
1172015635 20:31870817-31870839 CGGGGCCCGCAGGGACGTCCAGG - Intronic
1174204261 20:48827791-48827813 CTGCGCCCACCCGGACCCCCGGG - Exonic
1180955824 22:19740802-19740824 CGGCGCCCGCCCGGGCCTTGTGG + Intergenic
1185321036 22:50200434-50200456 CGGTGCCCGCCCAGCCCTCCGGG + Intergenic
953440264 3:42910217-42910239 CGGCGCCCGCCTGCAATCCCAGG + Intronic
956729213 3:72181410-72181432 CGGCCCCTGCCAGGTCTTCCTGG + Intergenic
962030407 3:131594006-131594028 CCACGCCTGCCCGGCCTTCCAGG + Intronic
962770836 3:138608973-138608995 CTGCGCCCGCCCGGACGCCTCGG + Intronic
964570794 3:158105844-158105866 CGCCGGCCGCCCGGACTGCCGGG + Exonic
968519647 4:1029696-1029718 CCGCCCCCGCCCGGCCCTCCTGG + Intergenic
968803194 4:2756303-2756325 CGGCGGCCGCGCGGCCTCCCGGG - Exonic
985549219 5:524630-524652 CCGCGACCTCCCGGACCTCCAGG - Intergenic
999259643 5:150230027-150230049 CCGAGCCCGCCCGGCCTGCCAGG - Intronic
1000032801 5:157419079-157419101 CGGCGCCCGCCTGCAATCCCGGG - Intronic
1004216849 6:13711488-13711510 CGGCGGCTGCCCGGACATCCCGG + Exonic
1006642630 6:35496879-35496901 CGGCGTCCGCCCGGCTTACCTGG + Exonic
1007927832 6:45663926-45663948 CGGCCCCTGCCCCGGCTTCCTGG + Intronic
1015220661 6:130801571-130801593 CACCGCCCGCCCCGACCTCCCGG + Intergenic
1015440379 6:133241081-133241103 CGGCGCCACCCGGGACATCCAGG + Intronic
1016590193 6:145735435-145735457 CGGCGCCCGGCCGGAGCTGCTGG - Exonic
1019712378 7:2523608-2523630 CGGCGCCCGCCTGGGCCTGCCGG - Intronic
1021932610 7:25596662-25596684 GGGCTCCTGCCCGGACTTACAGG + Intergenic
1026736934 7:72954762-72954784 CTGCCCCCGCCCGGACTTCCGGG + Intergenic
1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG + Intronic
1027106798 7:75410301-75410323 CTGCCCCCGCCCGGACTTCCGGG - Intronic
1029730174 7:102433613-102433635 CGGCTCCCGCTCGGACTGCGTGG - Exonic
1032037332 7:128530746-128530768 CGGACCCCGCCCGGATTTCCCGG - Intergenic
1034218140 7:149423143-149423165 CGAGGCCCGCCCGCCCTTCCTGG - Intergenic
1034399491 7:150852676-150852698 GGGCTCCCGCCCTCACTTCCTGG - Intronic
1035187716 7:157139168-157139190 CGGCGCCCGCCCGCCCGGCCCGG - Exonic
1035612164 8:973830-973852 CACCGCCCGCCCCGACCTCCCGG - Intergenic
1041511475 8:58659238-58659260 CGGACCCCGCGCGGCCTTCCGGG + Exonic
1049799945 8:144513081-144513103 CGCCGACAGCACGGACTTCCTGG - Exonic
1050862202 9:10449170-10449192 CGGCACCCGCCCGCAATCCCAGG - Intronic
1055580699 9:77703687-77703709 CGGCGCCCGCCTGCAATCCCAGG + Intergenic
1056097675 9:83272234-83272256 CGGCGCCCGCCTGCAATCCCAGG - Intronic
1057054416 9:91949897-91949919 CGGCGGCCGCCCAGACGGCCGGG + Exonic
1057773083 9:97984199-97984221 CCGCGCCCGCCCAGGCCTCCAGG - Intronic
1057869712 9:98708696-98708718 CGGCGGCGGCCCGGGCTGCCCGG + Exonic
1062037201 9:134387748-134387770 CGGCGCCAGCCCTGACTAGCTGG + Intronic
1062582424 9:137234450-137234472 CGGCGCCCGCGAGGACGGCCAGG - Exonic
1062594943 9:137295398-137295420 CGGCGCCCGCCCCGCCTCCCTGG + Intergenic
1185508314 X:644651-644673 CCCCGCGCGCCCGGACTCCCGGG + Exonic
1192145688 X:68680726-68680748 CGGCCCCCACCCCCACTTCCTGG - Intronic
1198005557 X:132489578-132489600 CGGCCCCAGCCCGGGCTGCCTGG - Intronic
1200210610 X:154345251-154345273 CGGCGCCCTCCTGGACTTACTGG + Intergenic
1200220242 X:154386841-154386863 CGGCGCCCTCCTGGACTTACTGG - Intergenic