ID: 1026789145

View in Genome Browser
Species Human (GRCh38)
Location 7:73320341-73320363
Sequence GTTCCCGCCCTGGTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026789145_1026789153 12 Left 1026789145 7:73320341-73320363 CCCAGGGAAACCAGGGCGGGAAC 0: 3
1: 0
2: 1
3: 5
4: 128
Right 1026789153 7:73320376-73320398 GGTACCCTTGAGTCCAAAACAGG 0: 3
1: 0
2: 0
3: 3
4: 70
1026789145_1026789148 -9 Left 1026789145 7:73320341-73320363 CCCAGGGAAACCAGGGCGGGAAC 0: 3
1: 0
2: 1
3: 5
4: 128
Right 1026789148 7:73320355-73320377 GGCGGGAACCAGAGCCACCCAGG 0: 3
1: 0
2: 1
3: 24
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026789145 Original CRISPR GTTCCCGCCCTGGTTTCCCT GGG (reversed) Intronic