ID: 1026789145

View in Genome Browser
Species Human (GRCh38)
Location 7:73320341-73320363
Sequence GTTCCCGCCCTGGTTTCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 3, 1: 0, 2: 1, 3: 5, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026789145_1026789148 -9 Left 1026789145 7:73320341-73320363 CCCAGGGAAACCAGGGCGGGAAC 0: 3
1: 0
2: 1
3: 5
4: 128
Right 1026789148 7:73320355-73320377 GGCGGGAACCAGAGCCACCCAGG 0: 3
1: 0
2: 1
3: 24
4: 182
1026789145_1026789153 12 Left 1026789145 7:73320341-73320363 CCCAGGGAAACCAGGGCGGGAAC 0: 3
1: 0
2: 1
3: 5
4: 128
Right 1026789153 7:73320376-73320398 GGTACCCTTGAGTCCAAAACAGG 0: 3
1: 0
2: 0
3: 3
4: 70

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026789145 Original CRISPR GTTCCCGCCCTGGTTTCCCT GGG (reversed) Intronic
900203040 1:1419871-1419893 GATCCCGCCCTGGTCTCCACGGG + Intronic
900393915 1:2445358-2445380 CTCACTGCCCTGGTTTCCCTGGG - Intronic
900866576 1:5273236-5273258 TTTGCAGCCCTGGTTTCACTTGG - Intergenic
901144733 1:7057265-7057287 GCTCCCGTCCCGGTTCCCCTGGG + Intronic
902596013 1:17509896-17509918 CTGCCTGCCTTGGTTTCCCTGGG + Intergenic
904473209 1:30748475-30748497 CTGCCCACCCTGATTTCCCTGGG + Intronic
908354257 1:63316301-63316323 GTTCCAGCCCAGTCTTCCCTTGG - Intergenic
908612610 1:65879245-65879267 GTTCTGGGCCTGTTTTCCCTGGG - Intronic
908649545 1:66316908-66316930 GTTCCGGCCCTAATTTCCCCTGG - Intronic
913559252 1:120001282-120001304 GTTCCCTCCAAAGTTTCCCTCGG - Intronic
913638612 1:120789260-120789282 GTTCCCTCCAAAGTTTCCCTCGG + Intergenic
914279846 1:146160725-146160747 GTTCCCTCCAAAGTTTCCCTCGG - Intronic
914540884 1:148611643-148611665 GTTCCCTCCAAAGTTTCCCTCGG - Intronic
914625756 1:149459603-149459625 GTTCCCTCCAAAGTTTCCCTCGG + Intergenic
916457496 1:164986083-164986105 GTGCCCTACCTGGGTTCCCTGGG + Intergenic
920052565 1:203172580-203172602 ATACCCGCCCTGGCTTCACTTGG - Intronic
923295863 1:232594432-232594454 GTCCCCGCCCTGGCTCCGCTCGG - Intergenic
1066521457 10:36224533-36224555 TTTCCCTCCCTGTTCTCCCTTGG - Intergenic
1069590962 10:69641583-69641605 GATCCAGCCCTGGTTTCTCAAGG - Intergenic
1073095826 10:100979097-100979119 CTTCCCTCCCAGGTCTCCCTGGG - Exonic
1073510610 10:104040343-104040365 GTTCTCACCTTGGTCTCCCTTGG + Exonic
1084391570 11:68880684-68880706 GTTCCAGCCCTGGAGTCCTTTGG + Intergenic
1084946740 11:72642607-72642629 TGTCTCGCCCTGGGTTCCCTCGG + Intronic
1087122345 11:94588223-94588245 GTTCCTGCCCTGGTTTGCTGAGG + Intronic
1088041496 11:105389927-105389949 GTTCCCGTCCTTGATTTCCTTGG - Intergenic
1089329083 11:117677452-117677474 GCTCCCTCCCTGGCTTTCCTGGG - Intronic
1089696019 11:120216767-120216789 GTTCCCTCCCAGGCTTCCCAAGG + Intronic
1090327949 11:125904804-125904826 GTTCCCACCCTGGATTTCCAGGG - Intronic
1090381830 11:126332702-126332724 GGTTCAGCCCTGGTCTCCCTGGG + Intronic
1091998101 12:5010999-5011021 GGTCCCGCTCTGGGTTCTCTAGG - Intergenic
1091998109 12:5011051-5011073 GGTCCCGCTCTGGGTTCTCTAGG - Intergenic
1092095881 12:5841609-5841631 GCTCCCACCCTGGCTCCCCTTGG + Intronic
1093547056 12:20360674-20360696 GTTCCCTTCCTGTATTCCCTAGG - Intergenic
1095599933 12:44002603-44002625 CTTCCCTCCCTCCTTTCCCTGGG + Intronic
1098085247 12:66835594-66835616 GTTCCCTCCATGGTTTTCCATGG - Intergenic
1103692966 12:122790746-122790768 GTTCCAGCCCTGTCTTCACTTGG + Intronic
1103818472 12:123678012-123678034 GTGCCCTCCCTGGGTTCCCATGG + Intronic
1103884533 12:124190860-124190882 GTTCCTGTGCTGGTTTCACTTGG + Intronic
1105712199 13:23022337-23022359 GTTCCCAGCCTGTTTTCCTTGGG + Intergenic
1107015714 13:35706526-35706548 GCTCCCTCCCTGGCTCCCCTGGG - Intergenic
1111847034 13:93523945-93523967 GTTCCCACCCTGTTTTTCCCAGG - Intronic
1112003809 13:95236939-95236961 GCTGCGGCCCTGGTTGCCCTTGG - Intronic
1122112428 14:99511723-99511745 GTGCCTGCCTTGGTTTCCTTTGG + Exonic
1123971073 15:25508285-25508307 GATTCCTGCCTGGTTTCCCTAGG - Intergenic
1125250442 15:37696067-37696089 TTGCCAGCCTTGGTTTCCCTGGG - Intergenic
1126666004 15:51077120-51077142 GCTCCCTCCCCTGTTTCCCTGGG + Intronic
1129840098 15:78738524-78738546 CTACCAGCCCTGGTGTCCCTTGG - Intergenic
1129908923 15:79209931-79209953 GTTCCCGCTCTGGGTGCCCGAGG + Intergenic
1130209403 15:81909540-81909562 GCTCCCTCCCTGCCTTCCCTTGG - Intergenic
1130546115 15:84858350-84858372 TCTCCCGCCCTGGAGTCCCTGGG - Exonic
1136512093 16:30744297-30744319 GTTCTCCTCCTGCTTTCCCTTGG + Intronic
1139234162 16:65317062-65317084 TTTCCTGGCCTGGTTTCACTTGG - Intergenic
1143787371 17:9265979-9266001 ACTCCCTCCCTGGTATCCCTAGG - Intronic
1146534622 17:33639493-33639515 GTTCCCACTCTGGGGTCCCTGGG + Intronic
1147218656 17:38915339-38915361 GTTCCAGCCCTGGTGTACCATGG + Intronic
1148565584 17:48631192-48631214 CTTCCATCCCTGGTGTCCCTTGG - Intronic
1149856546 17:60087976-60087998 CTTCCCGCACTCCTTTCCCTGGG - Intergenic
1151825868 17:76523833-76523855 GTTCCAGCTCTGGCTTGCCTGGG + Intergenic
1151876547 17:76870370-76870392 CTTCCCGCCCTGCTTCCCATGGG - Intronic
1152644401 17:81462082-81462104 GAGCCCGCCCCGGTTTCCTTGGG - Intronic
1152796249 17:82309027-82309049 ATTCCATCCGTGGTTTCCCTGGG + Intergenic
1152928600 17:83099082-83099104 GTCCCGGCCCTGGCTGCCCTCGG + Intergenic
1153698433 18:7667756-7667778 TTTTCCGCCATGGTTTGCCTCGG + Intronic
1156158047 18:34327442-34327464 GTTCCCTTCTTTGTTTCCCTGGG - Intergenic
1160817925 19:1044804-1044826 GTTCCCACCCTGGTGTTCCCAGG + Intronic
1161469243 19:4448067-4448089 TTTCCCACCCTGGCTTCCTTGGG - Intronic
1164615795 19:29666027-29666049 GTGCCCGACCCTGTTTCCCTTGG - Intronic
1165184214 19:34002800-34002822 GTTCCCACCCTGGCTCTCCTGGG - Intergenic
1165773094 19:38389545-38389567 CTTTCCCCCCTGGCTTCCCTCGG + Intronic
1167531592 19:50021059-50021081 GCTCGCTCCCTGGTTTCCTTTGG - Intronic
925060288 2:885524-885546 CTCCCCACCCTCGTTTCCCTGGG - Intergenic
928167176 2:28979941-28979963 GTCCCCGCCCTGGGTTCCCATGG + Intronic
931205198 2:60139929-60139951 GTCCACACCCTGTTTTCCCTTGG - Intergenic
933970941 2:87469272-87469294 GTTCCAGCCCAGGTGTCACTGGG + Intergenic
935342530 2:102070547-102070569 GGGCCCGCCCTGGCTTCCTTGGG + Intronic
936322786 2:111480917-111480939 GTTCCAGCCCAGGTGTCACTGGG - Intergenic
938906870 2:135845501-135845523 GTTTCTGCCCTTGTTCCCCTGGG - Intronic
939637161 2:144596130-144596152 GCTCCCTCCCAGGTTTCCTTTGG + Intergenic
940734869 2:157439475-157439497 TTTCCTGCCCCGCTTTCCCTAGG + Intronic
947914757 2:233823920-233823942 GTGCCCTCCCTGGGTCCCCTGGG - Intronic
1169174946 20:3502786-3502808 GTGCCCACCCTGGTGTCTCTGGG - Intronic
1175660004 20:60804313-60804335 GTTCCTGCACTGGTTTGCTTAGG + Intergenic
1175741932 20:61425608-61425630 GCTGCCGCCCTGTTTTCCCTGGG - Intronic
1176072662 20:63235143-63235165 TGTCCCGCCCAGGTGTCCCTGGG + Intergenic
1178618961 21:34157936-34157958 TTTCCCACCCTGGCTTCCCAGGG - Intergenic
1180088014 21:45516726-45516748 GGTCCCTCCCTGGTGTCCCAGGG - Intronic
1180728073 22:17961077-17961099 ATGCCCACCCTGGTGTCCCTAGG - Intronic
1181892661 22:26077481-26077503 CTCCCAGCCTTGGTTTCCCTAGG - Intergenic
1182927295 22:34137440-34137462 GATTCCATCCTGGTTTCCCTGGG + Intergenic
1185237630 22:49724205-49724227 CTTCCCGCCCCGGTGTCCCCAGG - Intergenic
950422242 3:12905962-12905984 GTCTCAGCCCTGGTCTCCCTTGG - Intronic
951440331 3:22715362-22715384 GTTCCAGCCCTCAGTTCCCTGGG + Intergenic
954132356 3:48567137-48567159 TTTCTCGCCCTGGTCACCCTTGG + Exonic
954936631 3:54332960-54332982 CTTCACTCCCTGGGTTCCCTGGG - Intronic
959194950 3:103167999-103168021 GTTCCCGTCCCGGTTTACCTGGG + Intergenic
960294851 3:115930502-115930524 TTTCCCAGCCTGATTTCCCTAGG - Intronic
964118944 3:153162542-153162564 GTTTCCGCCCTGCGTTCTCTGGG + Exonic
966906452 3:184529683-184529705 GTACCTGCCCTTCTTTCCCTGGG - Intronic
967803659 3:193693122-193693144 GTTCCCTCCCTGGCTACGCTCGG + Intronic
968185054 3:196627233-196627255 ATTGCAGCTCTGGTTTCCCTGGG + Intergenic
969436758 4:7193170-7193192 GGTCCCGCCCGGGTGTCCCGCGG - Intronic
975529427 4:75385608-75385630 GTTCCCTCTCTGGTGGCCCTAGG + Intergenic
976142238 4:82004279-82004301 GTTCCCTCTCTGGGTTTCCTTGG - Intronic
976275705 4:83275377-83275399 GTTCCCAACCTGGTTTCCACTGG + Intronic
981532484 4:145765617-145765639 GTTCCCGCCCTTGTTTTTCTGGG + Exonic
983007414 4:162501027-162501049 TTTCCCAGCCTGGTTTTCCTGGG + Intergenic
986541200 5:8845426-8845448 GTCTCCGCCCTTGTTTACCTAGG - Intergenic
988463889 5:31468924-31468946 GTTGGCTGCCTGGTTTCCCTGGG + Intronic
989455932 5:41644388-41644410 GTTCCTGCACTGGTTTGCTTAGG - Intergenic
998158270 5:139798251-139798273 GTTCCTGCCCTGGTCTCCCTGGG + Intronic
999199508 5:149805904-149805926 GTTCCCACACTGGGCTCCCTGGG - Intronic
1000752599 5:165115114-165115136 CTTCCCGCCTCGGCTTCCCTAGG - Intergenic
1001956716 5:175852785-175852807 CTGCCCGCCCTGCTTTCTCTGGG - Intronic
1006931541 6:37692014-37692036 GTACCCACCCCGGTGTCCCTAGG - Intronic
1013990631 6:116251097-116251119 GTTTCTGCCCTGATGTCCCTTGG - Exonic
1020637080 7:10709743-10709765 GCTCCCGCCCTTCTTTCCCCAGG - Intergenic
1021999328 7:26210044-26210066 GTTCCTGCTTTGGTTTCCCAAGG - Intronic
1026377031 7:69762154-69762176 GTTCCTGTCCTGATTTCTCTGGG + Intronic
1026738108 7:72961544-72961566 GTTCCCGCCCTGGTTTCCCTGGG - Intronic
1026789145 7:73320341-73320363 GTTCCCGCCCTGGTTTCCCTGGG - Intronic
1027105626 7:75403524-75403546 GTTCCCGCCCTGGTTTCCCTGGG + Intronic
1036211001 8:6841424-6841446 GCTCCGGCCCAGGTGTCCCTGGG + Intergenic
1040980835 8:53244866-53244888 GGTCCTGCCTTGGTATCCCTGGG + Intronic
1041661759 8:60407786-60407808 CTTCCCACACTGGTTTCCCATGG - Intergenic
1045222670 8:100213642-100213664 GTCCCCGCCGGGTTTTCCCTTGG + Intronic
1046761671 8:118027839-118027861 GTTCCCTTCCTGGTTGCCTTGGG + Intronic
1051407116 9:16749450-16749472 TTTCCCGCCCTGGTCTCCCAGGG - Intronic
1052970952 9:34376921-34376943 GGTCCCGCCCTGGGGTTCCTCGG + Intergenic
1057494857 9:95553070-95553092 GTTCCGGCCCTGCTGGCCCTCGG - Intergenic
1059363076 9:113762700-113762722 GTTCCCTCCCTGCTCTGCCTAGG + Intergenic
1060915127 9:127384400-127384422 GTGCCTGCCCTGGCTGCCCTGGG - Intronic
1060917253 9:127398522-127398544 GTTCCTGTCCTGATTTCTCTTGG + Intronic
1061227383 9:129288651-129288673 GTTACGGTCCTGCTTTCCCTGGG + Intergenic
1062193108 9:135257705-135257727 GCTGCAGCCCTGGCTTCCCTGGG + Intergenic
1185790583 X:2925910-2925932 ATTCCTGCACTGGTGTCCCTGGG + Intronic
1185876566 X:3706738-3706760 GTGCACGCCCTGCTTTCCCGGGG + Intronic
1194666704 X:96684547-96684569 GTTCCCTCCCTGTTCTCGCTGGG + Intergenic