ID: 1026796002

View in Genome Browser
Species Human (GRCh38)
Location 7:73366517-73366539
Sequence TGAGGTCCACACTGTGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026796002_1026796005 0 Left 1026796002 7:73366517-73366539 CCACACACACAGTGTGGACCTCA No data
Right 1026796005 7:73366540-73366562 GTACCCTCCACACAAGGTACAGG No data
1026796002_1026796010 25 Left 1026796002 7:73366517-73366539 CCACACACACAGTGTGGACCTCA No data
Right 1026796010 7:73366565-73366587 AGTCACTTATCAGCCAGGCATGG No data
1026796002_1026796009 20 Left 1026796002 7:73366517-73366539 CCACACACACAGTGTGGACCTCA No data
Right 1026796009 7:73366560-73366582 AGGAAAGTCACTTATCAGCCAGG No data
1026796002_1026796011 28 Left 1026796002 7:73366517-73366539 CCACACACACAGTGTGGACCTCA No data
Right 1026796011 7:73366568-73366590 CACTTATCAGCCAGGCATGGTGG No data
1026796002_1026796003 -6 Left 1026796002 7:73366517-73366539 CCACACACACAGTGTGGACCTCA No data
Right 1026796003 7:73366534-73366556 ACCTCAGTACCCTCCACACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026796002 Original CRISPR TGAGGTCCACACTGTGTGTG TGG (reversed) Intergenic
No off target data available for this crispr