ID: 1026798718

View in Genome Browser
Species Human (GRCh38)
Location 7:73383459-73383481
Sequence AACTCCTTGTAGATGTATGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026798718_1026798722 3 Left 1026798718 7:73383459-73383481 CCAACATACATCTACAAGGAGTT No data
Right 1026798722 7:73383485-73383507 TAGAAGGGAGAAGAGGCAAATGG No data
1026798718_1026798724 11 Left 1026798718 7:73383459-73383481 CCAACATACATCTACAAGGAGTT No data
Right 1026798724 7:73383493-73383515 AGAAGAGGCAAATGGTGGAGAGG No data
1026798718_1026798723 6 Left 1026798718 7:73383459-73383481 CCAACATACATCTACAAGGAGTT No data
Right 1026798723 7:73383488-73383510 AAGGGAGAAGAGGCAAATGGTGG No data
1026798718_1026798721 -4 Left 1026798718 7:73383459-73383481 CCAACATACATCTACAAGGAGTT No data
Right 1026798721 7:73383478-73383500 AGTTCTATAGAAGGGAGAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026798718 Original CRISPR AACTCCTTGTAGATGTATGT TGG (reversed) Intergenic
No off target data available for this crispr