ID: 1026798723

View in Genome Browser
Species Human (GRCh38)
Location 7:73383488-73383510
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026798718_1026798723 6 Left 1026798718 7:73383459-73383481 CCAACATACATCTACAAGGAGTT No data
Right 1026798723 7:73383488-73383510 AAGGGAGAAGAGGCAAATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026798723 Original CRISPR AAGGGAGAAGAGGCAAATGG TGG Intergenic
No off target data available for this crispr