ID: 1026800237

View in Genome Browser
Species Human (GRCh38)
Location 7:73395847-73395869
Sequence TACCCTCAGCGCCCAGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026800231_1026800237 6 Left 1026800231 7:73395818-73395840 CCTGCAGCCTCTGCCAGGACGAG No data
Right 1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG No data
1026800232_1026800237 -1 Left 1026800232 7:73395825-73395847 CCTCTGCCAGGACGAGAGCCTCT No data
Right 1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG No data
1026800229_1026800237 26 Left 1026800229 7:73395798-73395820 CCAATTAAATGAATTACGTGCCT No data
Right 1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG No data
1026800233_1026800237 -7 Left 1026800233 7:73395831-73395853 CCAGGACGAGAGCCTCTACCCTC No data
Right 1026800237 7:73395847-73395869 TACCCTCAGCGCCCAGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026800237 Original CRISPR TACCCTCAGCGCCCAGGGCA TGG Intergenic
No off target data available for this crispr