ID: 1026811039

View in Genome Browser
Species Human (GRCh38)
Location 7:73465236-73465258
Sequence CTCTATATATAGATGGCCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026811039 Original CRISPR CTCTATATATAGATGGCCAA AGG Intronic
900530405 1:3150245-3150267 CTCAATTTTTAGATAGCCAAGGG - Intronic
902155472 1:14482104-14482126 CTGCATGGATAGATGGCCAAAGG + Intergenic
902926426 1:19698742-19698764 CTCCATAAAGAGATGGCCCAGGG + Intronic
903147700 1:21385817-21385839 CTCTATATATATATTGGCACTGG + Intergenic
906869063 1:49456378-49456400 CTCTAGAAATGGATGGCCAGAGG - Intronic
907859486 1:58337756-58337778 CTCTGTATATAAATGGAGAAAGG + Intronic
911972938 1:104460578-104460600 GTCTGCATATAGATGACCAAGGG - Intergenic
912740191 1:112187332-112187354 CTATATACATACATGGCAAATGG - Intergenic
916371383 1:164099337-164099359 CTCTATTTAAAGATGGGCAAAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919316781 1:195980623-195980645 CCCTAGATAAAGATAGCCAAAGG - Intergenic
924198253 1:241632806-241632828 CTCTATAAATAGATTACCCAAGG - Exonic
1062897224 10:1113201-1113223 CTCTATAAATGGATCACCAAAGG + Intronic
1064581149 10:16794255-16794277 CTCCATATATATATTGCCTATGG + Intronic
1065234401 10:23633875-23633897 CTCTATATGTATATATCCAAAGG - Intergenic
1067146745 10:43699894-43699916 CTCTATGTATAGATGTACATAGG + Intergenic
1073760684 10:106625292-106625314 CACAATATTTAGGTGGCCAAAGG - Intronic
1073947440 10:108767276-108767298 CTCTGTTTCTAAATGGCCAATGG + Intergenic
1075974334 10:126682567-126682589 CTCTATAAATAGTTGTTCAATGG + Intergenic
1078507140 11:11960668-11960690 CCCTGTATAAAGATGACCAAGGG - Intergenic
1078656152 11:13242003-13242025 CTCAATAGATCAATGGCCAAAGG - Intergenic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1083090289 11:60192361-60192383 ATCTACACATAGATGACCAAGGG + Intergenic
1085175553 11:74484263-74484285 CTCTCTCAATAAATGGCCAAAGG - Intergenic
1085293382 11:75416159-75416181 CTCTACATGCAGATGACCAAAGG - Intronic
1086056938 11:82658052-82658074 CTCTATAAAAAAATGGGCAAAGG + Intergenic
1087949650 11:104205033-104205055 TTCTATATATACATTGCCTATGG + Intergenic
1088819404 11:113444632-113444654 CACCATTTATAGATGGCCCATGG - Intronic
1090042120 11:123300365-123300387 ATATATATATTTATGGCCAAGGG + Intergenic
1092040688 12:5381332-5381354 CTTTATATATATATAACCAAAGG + Intergenic
1095039933 12:37429634-37429656 CTCTATATATATATGGAAAAGGG - Intergenic
1095039953 12:37430097-37430119 CTCTATATATATATGGAAAAGGG - Intergenic
1098278945 12:68843280-68843302 CTCTCTCAATAAATGGCCAAAGG - Exonic
1100111531 12:91249388-91249410 ATATATATATATAAGGCCAATGG - Intergenic
1101292959 12:103389749-103389771 CTCTATATCTTCATGGACAATGG - Intronic
1101530114 12:105566108-105566130 CTCTTGATATAGATTGACAATGG + Intergenic
1102655176 12:114476705-114476727 CTATATATATAAATGTGCAAAGG + Intergenic
1104632053 12:130411522-130411544 TTCTAAATGTCGATGGCCAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107793289 13:44024493-44024515 CTTTATATTTAGATGACCAATGG - Intergenic
1108584013 13:51852312-51852334 CCCAATAGATAAATGGCCAAAGG - Intergenic
1111036393 13:82679825-82679847 CAGTATAAATAGATGGCTAATGG - Intergenic
1112445882 13:99463686-99463708 CTCTATCCATAGATGGCTTAAGG - Intergenic
1120534682 14:85679809-85679831 ATATATATATATATGGCCACAGG - Intergenic
1121202240 14:92128054-92128076 CTCTTTAAATTCATGGCCAAAGG - Intronic
1121316903 14:92967248-92967270 CTCTATTTAAAAATGGGCAAAGG + Intronic
1123754576 15:23386888-23386910 CTCTACATAAATATGCCCAAAGG - Intergenic
1125271440 15:37942959-37942981 CTCTATATATATATAGTCCAGGG + Intronic
1127332135 15:57949762-57949784 CTACATAGATAAATGGCCAAAGG + Intergenic
1128571109 15:68733494-68733516 ATGTATATATAAATGGCCAGAGG + Intergenic
1130559019 15:84944448-84944470 TTCTATTAATAGATGGCCAGAGG - Intronic
1134461796 16:14436101-14436123 CTCTACATAAATATGCCCAAAGG + Exonic
1137922659 16:52506261-52506283 CTCTTTATACACATGTCCAAAGG + Intronic
1139109100 16:63867142-63867164 TTATATAAATACATGGCCAATGG + Intergenic
1158510757 18:58088500-58088522 CTTTGTATATAGAGGCCCAAGGG - Intronic
1160323345 18:77916888-77916910 CTCTAAATATAAAAGGCCAGTGG + Intergenic
1163942806 19:20510685-20510707 GTCTACACATAGATGACCAAGGG - Intergenic
1163992286 19:21009752-21009774 GTCTACACATAGATGACCAAGGG + Intergenic
1164381145 19:27738028-27738050 CTCTATTTCTAGATTGCCAGGGG + Intergenic
1164696913 19:30251940-30251962 CTATATATATATATGTGCAATGG - Intronic
1165164521 19:33842200-33842222 CCCTATATAAAGATGGGGAATGG - Intergenic
1165897645 19:39152827-39152849 CTGTATATATAGTTGGCCCTGGG + Intronic
925823233 2:7821758-7821780 CCATATATATAGATGTCAAAAGG + Intergenic
926785167 2:16511142-16511164 TTCTCTATCTAGATGGCCCAGGG - Intergenic
927260334 2:21081903-21081925 CTCAATATATAAATGGCAGAGGG - Intergenic
927962210 2:27247968-27247990 ATCTCCATATAGATGGCCCACGG - Intergenic
930846739 2:55914175-55914197 CTCTATCTATACATGGCCCCAGG + Intronic
931819076 2:65933531-65933553 CTCTATATTCAGAGGGCTAATGG - Intergenic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
935440340 2:103087299-103087321 ATATATATATATATGGGCAAAGG + Intergenic
935800807 2:106693677-106693699 CTCTATTTAAAAATGGTCAAAGG - Intergenic
936272820 2:111064047-111064069 TTCTATATATAGTTGTCCCAAGG + Intronic
936873952 2:117165897-117165919 CTATATATATAGATGACTAGTGG + Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
939149088 2:138451920-138451942 CTCTATTTAAAAATGGGCAAAGG - Intergenic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940424317 2:153513578-153513600 CTCTAGAGAAAGATGACCAATGG - Intergenic
940689991 2:156904540-156904562 CTTTATAGATAGATGCCCCATGG + Intergenic
947652108 2:231795633-231795655 ATCTACCTATAGGTGGCCAATGG - Intronic
1169107708 20:3011104-3011126 CTCTAAATAAACATGGTCAAGGG - Intronic
1169717235 20:8633529-8633551 CTGTAGATAGAGATGTCCAAGGG + Intronic
1171112172 20:22494348-22494370 CCTTATATTTAGAGGGCCAAGGG - Intergenic
1179307556 21:40168908-40168930 CTCTATATATAATGGGCCAATGG + Intronic
1182382628 22:29905256-29905278 CTATATATACAGCAGGCCAAGGG - Intronic
1182895170 22:33853481-33853503 TTCAACATCTAGATGGCCAAAGG + Intronic
1182927889 22:34143755-34143777 CTCTATTAAAAGATGGGCAAAGG - Intergenic
949103367 3:173587-173609 CTCTATATATAGAGAGAGAAAGG + Intergenic
951063675 3:18239139-18239161 CTCAATATAAAAATAGCCAAAGG + Intronic
952067852 3:29593533-29593555 CTTTATATAGTGATGGACAAGGG + Intronic
955069601 3:55561042-55561064 ATCAATATATCGATGGCCAAAGG + Intronic
959193316 3:103143389-103143411 CTCTAAATATATATGCCCTATGG + Intergenic
959700399 3:109293156-109293178 CTCTATATATATATAGCCTCTGG + Intergenic
960450605 3:117802287-117802309 CTCTTTATATAAATTGGCAATGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
970203448 4:13632501-13632523 ATTCATATATACATGGCCAAAGG + Intergenic
970954816 4:21797892-21797914 CACTATATATATGAGGCCAATGG + Intronic
977531112 4:98201277-98201299 CTATATATATATATAGACAATGG + Intergenic
978906872 4:114015847-114015869 CCCAATATAAAGAAGGCCAAAGG - Intergenic
981173092 4:141647501-141647523 ATGTATATATAGATGGCTTAGGG + Intronic
982587443 4:157260365-157260387 ACCTAGATATAGATGGTCAAGGG + Intronic
984193482 4:176631766-176631788 CTCTATGGGAAGATGGCCAAAGG - Intergenic
985535175 5:460627-460649 CTCTATGGATAGAGGGCCAATGG - Intronic
985535190 5:460691-460713 CTCTGTGGATAGAAGGCCAATGG - Intronic
989622016 5:43393775-43393797 CTATATATATCCAAGGCCAAGGG + Intronic
991636407 5:68710514-68710536 ATCTAAATATGGATGGCTAATGG - Intergenic
997017333 5:129951733-129951755 GTATCTACATAGATGGCCAATGG - Intronic
997843576 5:137264888-137264910 TTCTGTATATAAATAGCCAACGG + Intronic
998657437 5:144197523-144197545 CTCTATATATATTTGTCAAAGGG - Intronic
999507833 5:152216790-152216812 CTGTTTATTTAGATGCCCAATGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1007932439 6:45704463-45704485 TTCTGTATTTAGATGGACAAAGG - Intergenic
1008028318 6:46664212-46664234 CTCTATAGATAGATGAAGAATGG - Intronic
1013567098 6:111377254-111377276 CTTTCTATATAGTTGGCTAAGGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017212624 6:151873695-151873717 TTCTATACATATTTGGCCAAAGG - Intronic
1021849037 7:24790100-24790122 GTCTACATATAGATGATCAAGGG - Intergenic
1026811039 7:73465236-73465258 CTCTATATATAGATGGCCAAAGG + Intronic
1027906272 7:84186822-84186844 ATCTATATATAAGTGGCCTAAGG + Intronic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1029338770 7:99925700-99925722 CTCTATTTATAAATGGGAAAAGG + Intronic
1032146528 7:129387453-129387475 CGCTATATTTAAATGGCCATTGG + Intronic
1037513143 8:19603769-19603791 CTTTTTACTTAGATGGCCAAGGG - Intronic
1039174561 8:34788460-34788482 CTATATATATATATGTACAATGG - Intergenic
1040892574 8:52332867-52332889 ATATATATATATATGACCAATGG + Intronic
1041240488 8:55845074-55845096 CTCTAAATATAACTGCCCAAGGG + Intergenic
1045187594 8:99854834-99854856 CTGTCTATATAGCTGGCAAAGGG + Intronic
1048842336 8:138576979-138577001 ATCTATCTATAGATGGAAAATGG - Intergenic
1051019641 9:12526726-12526748 ATCTATACATATATGGTCAATGG - Intergenic
1051319376 9:15884367-15884389 ATCTATATATACCTGACCAAGGG - Intronic
1052508478 9:29383843-29383865 GTCTATACATAGATGATCAAGGG + Intergenic
1057295445 9:93833150-93833172 CCCAATCTATAGATGGGCAAAGG - Intergenic
1058403970 9:104650631-104650653 ATATATATATAGATGGTAAATGG - Intergenic
1186631066 X:11349401-11349423 CTTTATTTCTAGAGGGCCAAAGG - Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188306245 X:28562857-28562879 TTGTATATTTAGAGGGCCAAGGG - Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1194157422 X:90408877-90408899 CTCTCTATATAGATAGGCATAGG + Intergenic
1194618230 X:96134573-96134595 CTATATACATAGCTGGCCCAAGG + Intergenic
1194710349 X:97228958-97228980 AGCTATACATAGATGGACAAGGG - Intronic
1194807964 X:98353302-98353324 ATCTATATATATAGGGCCCAGGG - Intergenic
1195534704 X:105998093-105998115 ATATATATATATATAGCCAAAGG + Intergenic
1197171636 X:123441399-123441421 ATCAATATATAGACTGCCAAGGG + Intronic
1199028395 X:142967357-142967379 ATCTATAGATATATGGCAAATGG - Intergenic
1200503755 Y:3985862-3985884 CTCTCTATATAGATAGGCATAGG + Intergenic
1201685616 Y:16698659-16698681 CTTTATATATATATGGTAAAAGG - Intergenic