ID: 1026817145

View in Genome Browser
Species Human (GRCh38)
Location 7:73521945-73521967
Sequence CGGTGGGGACTGGCGGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026817141_1026817145 -8 Left 1026817141 7:73521930-73521952 CCATCGCGGCGGCGGCGGTGGGG 0: 1
1: 1
2: 6
3: 89
4: 488
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817130_1026817145 25 Left 1026817130 7:73521897-73521919 CCAGCGGGAAGGGCTTGCGGCCC 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817134_1026817145 5 Left 1026817134 7:73521917-73521939 CCCAGGAGCGGCGCCATCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817135_1026817145 4 Left 1026817135 7:73521918-73521940 CCAGGAGCGGCGCCATCGCGGCG 0: 1
1: 0
2: 1
3: 7
4: 72
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026817145 Original CRISPR CGGTGGGGACTGGCGGCTGC TGG Exonic
900104798 1:977261-977283 CGGTGGGGGCAGGCGGTTCCCGG - Intronic
900105004 1:977705-977727 CGGTGGGGGCAGGCGGTTCCCGG - Intronic
900105112 1:977941-977963 CGGTGGGGGCAGGCGGTTCCCGG - Intronic
900566109 1:3332713-3332735 CGGTGGGGAGTGAGTGCTGCTGG - Intronic
900623523 1:3598068-3598090 CTGTGGGGTCTGCAGGCTGCAGG - Intronic
900637533 1:3673266-3673288 AGGTGGGGTCTGCTGGCTGCCGG - Intronic
900990925 1:6097974-6097996 TGGTGGGAAGTGGCAGCTGCGGG + Intronic
901069807 1:6511514-6511536 CGGTGGGCATCGGCAGCTGCTGG - Intronic
901916582 1:12504935-12504957 CGCTGGGGGCTGGGGGCTGGGGG + Intronic
902926606 1:19700200-19700222 CCGTGAAGGCTGGCGGCTGCAGG - Intronic
902984665 1:20148361-20148383 CGCTGGGGATTGGTGACTGCAGG - Exonic
903077919 1:20786701-20786723 CGGCGGTGACTGGCTGCGGCGGG - Intronic
903078078 1:20787250-20787272 CGGAGGCGACTAGCGGCGGCGGG - Intronic
904006797 1:27367079-27367101 CTTTGGAGACTGGCGGCTTCCGG + Intergenic
904754177 1:32759027-32759049 TGGTGGGGAGAGGAGGCTGCTGG + Intronic
905166976 1:36088575-36088597 CGGTGGGGAGGGCCGGCTGGGGG + Intergenic
905617221 1:39409294-39409316 GGCCGGGGACTGGCGGCGGCGGG + Intronic
906144517 1:43551953-43551975 GGGTAGGGAGTGGCAGCTGCAGG - Intronic
906895316 1:49764272-49764294 CAGTGGAGACTGGTGGCTGTGGG - Intronic
909640455 1:77866469-77866491 CGGTGGGAATTGGCAGCTGTAGG + Intronic
910054277 1:83012644-83012666 AGGTGTGGCCTGGCAGCTGCAGG - Intergenic
915326695 1:155084567-155084589 CGGGGTGGACTGGCAGCCGCAGG + Intronic
916899733 1:169207790-169207812 CGGTGGGGAAGGGAGGGTGCTGG + Intronic
918904808 1:190478203-190478225 CGGTGGGGGGTGGGGGGTGCGGG + Intergenic
919981296 1:202644107-202644129 GGGTGGGGACCGCGGGCTGCCGG - Intronic
920458373 1:206117603-206117625 CGGTGTGTCCTGCCGGCTGCTGG - Intronic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
922766354 1:228158489-228158511 CGGGCAGGGCTGGCGGCTGCAGG - Exonic
923125628 1:231032373-231032395 GGGTGGGGGCTGGCGGGGGCGGG - Intronic
924089979 1:240492283-240492305 CGGTGGGGACTTGAGGATGGGGG + Exonic
924172538 1:241357100-241357122 CGGGCGCGAGTGGCGGCTGCCGG - Exonic
1064132816 10:12725082-12725104 CCGTGTGGACTGGGGGCAGCTGG + Intronic
1067769877 10:49115473-49115495 CGGCGGGGAGATGCGGCTGCTGG - Exonic
1067769895 10:49115536-49115558 CGGGGCGGGCTGGCGGCGGCCGG - Intergenic
1068003927 10:51370549-51370571 AGGCTGGGACTGGCTGCTGCTGG - Intronic
1068200882 10:53783013-53783035 TCGTGGGGGCTGGAGGCTGCAGG - Intergenic
1070398963 10:76036150-76036172 GGGTGGGGAGTGGGGGCAGCGGG - Intronic
1074881262 10:117661325-117661347 CTGTGGGCTGTGGCGGCTGCAGG + Intergenic
1076171517 10:128323975-128323997 GGGTGGGGAGTGGGGGCTGCAGG - Intergenic
1076188335 10:128465863-128465885 CAGTGAGGACTGGTGGCTCCCGG - Intergenic
1076567957 10:131411851-131411873 GGGTGGGGACAGGCGGCTGGAGG - Intergenic
1076687479 10:132204597-132204619 CTGCGGGGACTGTGGGCTGCAGG - Intronic
1076915546 10:133421624-133421646 CAGTGTGGACGGGAGGCTGCAGG + Exonic
1077176973 11:1195459-1195481 CAGTGGGGAGGGGCGGGTGCCGG + Intronic
1077235092 11:1478150-1478172 CTGTGGGGCCTGGCGGCGGTGGG - Intronic
1077413213 11:2413086-2413108 TGGAGGGGACTGGCGGGTGGTGG - Intronic
1079008768 11:16811484-16811506 AGGTGGAGGCTGGGGGCTGCTGG + Intronic
1079592063 11:22193105-22193127 CCGGGAGGAGTGGCGGCTGCGGG + Intergenic
1081594665 11:44450794-44450816 GGGTGGGGCCTTCCGGCTGCTGG + Intergenic
1081656562 11:44861431-44861453 CTGTGGGGACTGGTCGGTGCTGG + Intronic
1081682692 11:45019343-45019365 TGGTGGGGACAGGCGGCAGGGGG + Intergenic
1082820333 11:57540616-57540638 CAGTGGGGACTGGAAGATGCAGG + Intergenic
1083301395 11:61741260-61741282 CCGTGGGGAGTGGCTGCTGCTGG - Exonic
1083327052 11:61878216-61878238 CTGTGGAGACAGGCGGCGGCTGG + Intronic
1083657828 11:64238217-64238239 CCCTGGGCACTGGAGGCTGCAGG - Intronic
1083658106 11:64239855-64239877 CCCTGGGCACTGGAGGCTGCAGG - Intergenic
1083766430 11:64843640-64843662 CTGTGGGCACTGGCGCCAGCTGG - Intronic
1083780208 11:64913763-64913785 AGATGGGGAGTGGGGGCTGCTGG - Intronic
1083880625 11:65546692-65546714 CGGTGGTGATTGGCGTCTGGGGG - Intronic
1083993104 11:66258446-66258468 CGGTGCGGGCTGCCGGCTGGGGG + Intronic
1084014795 11:66371921-66371943 CGGAGAGGACGGGGGGCTGCGGG - Intronic
1084153412 11:67301710-67301732 CTGTGGGCTCTGGTGGCTGCAGG + Exonic
1084411568 11:69009065-69009087 CGCTGTGGAGTGGCGGCCGCAGG - Intronic
1084603230 11:70158843-70158865 CGGTGGGGGCTGGGGGCTGGGGG + Intronic
1088401318 11:109424135-109424157 CCTTGGGGACTGGAGGCTGGCGG - Exonic
1090733492 11:129591528-129591550 GGGTGGGGAGTTGCAGCTGCAGG - Intergenic
1090912679 11:131135182-131135204 CAGAGGGCACTGGGGGCTGCCGG - Intergenic
1091202521 11:133792937-133792959 CAGTGGTTACTAGCGGCTGCGGG + Intergenic
1091259760 11:134224909-134224931 CGGGGGAGGCTGGCGGCTGCGGG - Exonic
1091267324 11:134281635-134281657 AGGTGGGGCCCGGAGGCTGCAGG - Intronic
1091275084 11:134344644-134344666 AGGTGGGGCCCGGAGGCTGCAGG - Intronic
1091782973 12:3225462-3225484 CGGTGGGGAGTGACAGCTTCTGG + Intronic
1094063588 12:26340621-26340643 AGGTGGGGTCTGGAGGCTGGGGG + Intronic
1095907328 12:47391646-47391668 AGGTGGGGAGTGGCGGCCACAGG - Intergenic
1096781369 12:53994204-53994226 CAGCGGGGACTGGGGGCTTCGGG + Intronic
1098704651 12:73671944-73671966 CTGTGGGGAGGGGCGGCTGTGGG + Intergenic
1101736869 12:107469637-107469659 AGGTGGGCACTGCCTGCTGCTGG - Intronic
1103576045 12:121877990-121878012 CAGTGCAGACTGGTGGCTGCCGG + Intergenic
1106232283 13:27830061-27830083 CCGTGGGGCCTGCGGGCTGCGGG - Intergenic
1107481469 13:40789429-40789451 CGGTGGGCGGTGGCGGCTCCCGG + Intronic
1107838827 13:44435273-44435295 CGGTAGGAACTGGCTGCAGCCGG - Intronic
1108706579 13:52993906-52993928 GGGTGGGGGCTGGGGGCTGGTGG + Intergenic
1109087791 13:57998580-57998602 TGTTGGGGGCTGGGGGCTGCTGG - Intergenic
1109692348 13:65909817-65909839 GGGTGGGGGCTGGTGGCTGGGGG + Intergenic
1112328844 13:98462000-98462022 GGGTGGGGACTTGGGGCTGGTGG - Intronic
1113216349 13:108045143-108045165 GGGAGGGGCCTGGCGGCAGCTGG + Intergenic
1113716894 13:112516380-112516402 CAGTGGGGGCTGGAGGCCGCTGG + Intronic
1116162638 14:41289053-41289075 AGGAGGGGACTGGAGTCTGCTGG - Intergenic
1118463909 14:66013747-66013769 CGGGGGCGGCGGGCGGCTGCTGG + Intergenic
1121690778 14:95876192-95876214 CGGGGAGGGCCGGCGGCTGCGGG - Intergenic
1122151942 14:99730364-99730386 CGGTGAGGTCTGGCAGCTGCTGG + Intergenic
1122208650 14:100160807-100160829 GGATGGTGGCTGGCGGCTGCAGG - Intergenic
1122283142 14:100636028-100636050 GGGTGGGGGCTGGAGGCTGCTGG + Intergenic
1122899950 14:104778293-104778315 CGGTTGGGGCTGGGGGCTTCAGG - Intronic
1122901007 14:104782361-104782383 CGGTGGGGGCTGGCAGCAGTTGG - Intronic
1124157330 15:27237471-27237493 TGTTGGCGACTGCCGGCTGCTGG - Intronic
1128803631 15:70514243-70514265 CGGTGGGGTGTGGTGGCTCCTGG - Intergenic
1131102981 15:89708479-89708501 TGCTGAGGACTGGCAGCTGCTGG - Intronic
1131200066 15:90388481-90388503 GGGTGGGGCAGGGCGGCTGCCGG + Intronic
1132584950 16:702047-702069 CGGTGGGGCCTGGGTGCTCCTGG + Intronic
1132896232 16:2230604-2230626 CCCTGGGGACTGGCTGCAGCAGG + Intronic
1133011077 16:2912153-2912175 CGGTGAGGACAGGCCCCTGCGGG + Exonic
1133036164 16:3035511-3035533 CTGCGGGGACAGGTGGCTGCGGG + Exonic
1136016947 16:27406395-27406417 GGGTGGGGAGTGGGGGGTGCGGG + Intronic
1136116970 16:28100838-28100860 CGGTGGGAGCTGGGTGCTGCTGG - Intronic
1138182363 16:54950146-54950168 CGGTGGGGAATTTCAGCTGCAGG - Intergenic
1139529902 16:67537862-67537884 CGGTGGGGGCTGGGGGCAGCAGG + Intronic
1139754609 16:69132448-69132470 CGGGGGGCACGGGAGGCTGCGGG - Intronic
1140776057 16:78249833-78249855 GGGTGGGGGCTGGGGGCTGGGGG + Intronic
1141670520 16:85489358-85489380 CAGTGGGCACTGGGGGCTGGGGG + Intergenic
1142070048 16:88086975-88086997 GGGTGGGGACTGGCTGCTGGGGG - Intronic
1142354620 16:89596717-89596739 TGGTGGGGACTGGAGGCTTCTGG - Exonic
1142356738 16:89604938-89604960 GGGTGGGGAGCAGCGGCTGCGGG + Intergenic
1142359231 16:89618988-89619010 CGGGGGGGGCAGGGGGCTGCAGG - Intronic
1148000246 17:44383595-44383617 CGTGGGGGCCTCGCGGCTGCAGG + Exonic
1148053088 17:44778886-44778908 GGGTGGGGACTGGAGACTGGAGG - Intronic
1148471440 17:47896292-47896314 CGGTGGGTCCCGGCCGCTGCCGG + Exonic
1148667405 17:49384887-49384909 CTATGGGGCCTGGAGGCTGCTGG - Intronic
1148838587 17:50479761-50479783 CGGTGGGTAGTGGGGGCTGTAGG + Exonic
1151565072 17:74893222-74893244 CGGAGTGGACTGGCGGCGGCAGG - Intronic
1151705487 17:75764922-75764944 CGGCCGGGACAGGCGGCGGCGGG + Intronic
1151827461 17:76531191-76531213 CGGAGGGGCCTGGGGGTTGCAGG - Intronic
1152066959 17:78117389-78117411 GTGTGGGGACTGGCCGCTCCCGG - Intronic
1152125868 17:78446313-78446335 CGATGGGGAGTGGCTGCTTCAGG - Intronic
1152344499 17:79742974-79742996 GGGTGGGGGCTAGGGGCTGCGGG - Intergenic
1152556267 17:81054702-81054724 TGTGGGGGACTGGTGGCTGCAGG + Intronic
1152661535 17:81544561-81544583 CTGTGGGCACTGGGAGCTGCTGG + Intronic
1152702118 17:81824345-81824367 GGGTGGGGAGCGGGGGCTGCTGG + Exonic
1153056348 18:949959-949981 CAGTGGGGAGTGGCAGCAGCAGG + Intergenic
1156452506 18:37274731-37274753 CGGCGGGGCGTGGCGGGTGCTGG + Intronic
1156460536 18:37319131-37319153 CCGTGTGAACTGGGGGCTGCAGG + Intronic
1158120509 18:54043083-54043105 AGTTGGGGACTGGAGGCTGATGG - Intergenic
1158259076 18:55588017-55588039 CGGTAGGTACCGGCGCCTGCGGG - Intronic
1160769218 19:822616-822638 GGCTGGGGGCTGGGGGCTGCGGG + Intergenic
1160994425 19:1876092-1876114 CGGTGGTAAGTGGCGGCCGCTGG - Intergenic
1161013205 19:1969980-1970002 AGGTGGGGTCGGGAGGCTGCTGG + Intronic
1161130144 19:2583529-2583551 TGCTGGGGGCTGGTGGCTGCTGG + Intronic
1161130594 19:2586304-2586326 TGCTGGGGGCTGGTGGCTGCTGG + Intronic
1161260509 19:3335382-3335404 TGCTGGGGACAGGTGGCTGCAGG + Intergenic
1161270749 19:3388023-3388045 CGGGGCGGGCTGGCAGCTGCTGG - Intronic
1161324958 19:3659123-3659145 CGGAGGGGACTCGAGGTTGCCGG - Intronic
1162144569 19:8605744-8605766 CTGTGGGGGCTGCCGGCAGCCGG - Exonic
1162300948 19:9844651-9844673 TGATGGGGACTGTCGGGTGCTGG - Intronic
1162778761 19:12995933-12995955 CGGAGGGGACGCGCGGCGGCCGG + Intronic
1163433910 19:17283823-17283845 CAGTGGAGACTGGCAGGTGCCGG - Exonic
1163695069 19:18759934-18759956 CGGCGGGGACAGGGGGCTGGCGG - Intronic
1164833456 19:31340708-31340730 CCGGGAGGACTGGGGGCTGCAGG + Intronic
1165352242 19:35282122-35282144 CTGAGGAGCCTGGCGGCTGCTGG + Intronic
1167055587 19:47109949-47109971 CCGGGGGGACTGGGGGCTGGAGG + Intronic
1167492821 19:49801939-49801961 CGGTGAGGACAGGCGGCGCCCGG - Intronic
1168309408 19:55452931-55452953 CGGGGGCGACTGGGGGCTGCAGG - Intergenic
1168717599 19:58538549-58538571 TGATGGGGACTGGGGGCCGCGGG - Intronic
925464424 2:4094119-4094141 CGGTGTTCACTGGCAGCTGCTGG + Intergenic
925786075 2:7432183-7432205 GGGTGGGGGCGGGGGGCTGCGGG - Intergenic
927846337 2:26474381-26474403 GGGTGGGGCCTGGGGGCTGGAGG - Intronic
927846662 2:26475833-26475855 CTGTGGGGACTGGAGCCTGTGGG - Intronic
928420901 2:31137528-31137550 AGGTCGGGCCTGGCAGCTGCGGG + Intronic
928904606 2:36356176-36356198 CGGTGAGGACCGCGGGCTGCTGG + Exonic
929624929 2:43396659-43396681 CTGTGGGGACAGGGGGGTGCAGG + Intronic
931175267 2:59848100-59848122 CGGTGGGTACTGTGAGCTGCGGG - Intergenic
931370863 2:61661283-61661305 CAGTGGAGACTGGAGGCTGCAGG - Intergenic
933603228 2:84354486-84354508 CTGGGGGAAGTGGCGGCTGCGGG + Intergenic
934680925 2:96283510-96283532 AGGTGGGGCCTGGCGTCTGGGGG - Intronic
935592547 2:104855587-104855609 CGGCAGGGGCTGGCGGCGGCGGG + Exonic
936344503 2:111665114-111665136 CAGAGGGGAGTGGGGGCTGCGGG - Intergenic
937927372 2:127177463-127177485 CTGTGGGCACAGGAGGCTGCTGG - Intergenic
938406425 2:131035472-131035494 CTGTGGGGAGTGGGGGCTGCGGG + Intronic
938904511 2:135825705-135825727 CGTTGGGGAGTGGCCGCTGAGGG + Intronic
938964591 2:136377026-136377048 CGGAGGGCACTGGGGGCTGTTGG - Intergenic
946427765 2:219608489-219608511 TGGTGGGGCCTGGCGGGTGGAGG + Intronic
947722930 2:232380322-232380344 TGATGGGGGCTGGCGGGTGCAGG + Intronic
947819856 2:233062058-233062080 CAGTGGGGACCTGCTGCTGCCGG + Intronic
948614975 2:239192577-239192599 CTGTGGGCACTGGGGGCTACGGG + Intronic
948688670 2:239688255-239688277 TGGTGGAGCCTGGCTGCTGCAGG - Intergenic
948977693 2:241473538-241473560 CGGTAGGGACTGGCAGCTGCTGG - Intronic
948995007 2:241573579-241573601 CGGTGGGGACCGGGGCCGGCGGG + Exonic
949032681 2:241804432-241804454 GGGTGGGGAGTGGGGGATGCTGG + Intergenic
949079963 2:242088771-242088793 AGGTGAAGACTGGGGGCTGCAGG + Intergenic
949080068 2:242089150-242089172 AGGTGGGGTCTGGGGGCGGCCGG + Intergenic
1168757559 20:327117-327139 CGGAGGGGGCTGGCTGCTGGTGG - Exonic
1169288327 20:4328135-4328157 GGGTGGGGAATGGAGGCGGCAGG - Intergenic
1172865709 20:38095480-38095502 TGGTGGTGACTGGGCGCTGCTGG - Intronic
1174308745 20:49633928-49633950 CGGTGGGGGATGGGGGTTGCAGG + Exonic
1174794388 20:53510237-53510259 CGGTGAGGCCTGGAGGCTGCAGG + Intergenic
1175983734 20:62754097-62754119 AGGTGGGGAGTGGGGGCTCCAGG + Intronic
1176141761 20:63547931-63547953 CCGTGGGCACGGGCGGCTGTTGG - Intronic
1180096458 21:45557476-45557498 CGGTTGGGCCCGGAGGCTGCTGG + Intergenic
1180161445 21:46000262-46000284 CAGCGGGGACTGTGGGCTGCTGG - Intronic
1181029413 22:20142689-20142711 GGGTGCTGACTGGCGGCTGCAGG + Intronic
1181060770 22:20281101-20281123 AGGTGGGGACGGGCCGCTGGAGG - Intronic
1181277226 22:21694680-21694702 AGGTGGGGCGTGGCGGCTGGGGG + Intronic
1181383311 22:22524521-22524543 TGCTGGGGACTGGGGGCTGCTGG + Intergenic
1181513828 22:23400628-23400650 GGGTGCTGACTGGCAGCTGCAGG - Intergenic
1182439831 22:30356741-30356763 CCGTGGGCACGGGCGGCGGCGGG + Exonic
1182766190 22:32760010-32760032 GGGTGGGTACTGGCTGCTGGTGG - Intronic
1182766205 22:32760052-32760074 GGGTGGGTACTGGCTGCTGGTGG - Intronic
1183353581 22:37346856-37346878 CTGAGGGGACTGGGGGCTGGTGG - Intergenic
1183709165 22:39492327-39492349 CAGTGGGGAGAGGGGGCTGCAGG + Intergenic
1184149103 22:42628294-42628316 AGCTGGGGACTGAGGGCTGCGGG - Intronic
1185203116 22:49520702-49520724 GGGTGGGCTCTGGGGGCTGCTGG - Intronic
1185227948 22:49663908-49663930 CTCTGGGGTCTGGGGGCTGCAGG - Intergenic
1185273835 22:49941407-49941429 AGGTGGGGACTGGGAGCAGCAGG + Intergenic
950471889 3:13191447-13191469 GTGTGGGGACTGGGAGCTGCAGG - Intergenic
951012183 3:17693619-17693641 AGGTGGAGTCTAGCGGCTGCAGG - Intronic
953694395 3:45146324-45146346 CGGTGGGGAGCGGCGGCCCCAGG + Exonic
954622888 3:52005808-52005830 AGGAGGGGCCTGGGGGCTGCGGG + Intergenic
954860893 3:53689473-53689495 GGCTGGGGGCTGGGGGCTGCAGG + Intronic
960188758 3:114677309-114677331 GCCTGGGGACTGGCGGCTGCTGG - Intronic
960986846 3:123286430-123286452 TGGAAGGGACTGGGGGCTGCTGG - Intronic
961408640 3:126702800-126702822 GGGTGGGGACCGGGGGCCGCGGG - Intergenic
961509188 3:127390791-127390813 AGGTGGGGAGTGGGGACTGCGGG + Intergenic
961521818 3:127471415-127471437 AGGTGGGGACTGGGGGAGGCAGG + Intergenic
961536448 3:127573672-127573694 CGGGAGGGCCTGGAGGCTGCAGG - Exonic
961549434 3:127660654-127660676 CCCTGGGGTCTGGCTGCTGCTGG - Exonic
961791731 3:129381163-129381185 GGGTGCTGATTGGCGGCTGCAGG + Intergenic
961805755 3:129488116-129488138 GGGTGCTGATTGGCGGCTGCAGG + Intronic
961818423 3:129563117-129563139 CAGTGAGGAGTGGCTGCTGCGGG - Exonic
963864906 3:150350051-150350073 CGGTGGTGTCTTGCTGCTGCTGG + Intergenic
967104368 3:186243442-186243464 CGGTGTGGAGTGGGGGCCGCAGG - Intronic
967390094 3:188947116-188947138 GGGTGGGGACTGGAGGGAGCAGG + Intergenic
968377206 4:53542-53564 CGGCGGGAAATGGCGGCGGCGGG + Intronic
968384677 4:125388-125410 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968393686 4:213526-213548 AGGCAGGGACTGGCGTCTGCAGG + Intergenic
968401899 4:305236-305258 CGGCGGGAAATGGCGGCGGCGGG - Intronic
968405899 4:338704-338726 AGGCAGGGACTGGCGTCTGCAGG + Intronic
968519886 4:1030449-1030471 TGGTGGGGCCTGGCGGGTCCTGG + Intergenic
968525339 4:1054047-1054069 CGGAGGGGACAGTCAGCTGCCGG + Intergenic
968874061 4:3255984-3256006 CGGCGGGGCCGGGCGGCTGGTGG + Exonic
968943718 4:3652709-3652731 GAGTGGGGGCTGTCGGCTGCCGG + Intergenic
968978499 4:3834361-3834383 CGGAGGGGACTGGCTCCAGCTGG - Intergenic
970538598 4:17055341-17055363 TGGTGGGGACTGGTGGCTGGCGG - Intergenic
974716131 4:65670335-65670357 GGGGAGGGACTGACGGCTGCCGG + Exonic
975728614 4:77316468-77316490 AGGTGGTGGCTGGAGGCTGCTGG + Intronic
976565521 4:86547389-86547411 CGGTGGGGCCGGCCGACTGCTGG - Intronic
981782455 4:148444008-148444030 CGGCGGGGACTCCTGGCTGCGGG - Intronic
983937080 4:173509547-173509569 CGCTTCGGCCTGGCGGCTGCCGG + Intergenic
985493781 5:193413-193435 CGGTGGGTTCTGGGGGCTGGGGG + Intronic
985652085 5:1111997-1112019 GGACGGGGACTGTCGGCTGCAGG - Exonic
986171258 5:5316715-5316737 GGGTGGGCACTGCCAGCTGCTGG - Intronic
986191158 5:5497313-5497335 TGGGGAGGACAGGCGGCTGCAGG - Intergenic
986861665 5:11933324-11933346 CGGTGGGGGCTTACTGCTGCTGG + Intergenic
989515373 5:42337258-42337280 CGGTTGGTGCTGGCGGGTGCTGG - Intergenic
990416329 5:55590642-55590664 CTGAGGGGACTGGCTTCTGCTGG + Intergenic
992965635 5:81997109-81997131 GGCTGGGGACTGGAGGGTGCAGG - Intronic
996871889 5:128201441-128201463 CGGTGGCGGATGCCGGCTGCGGG - Intergenic
997727375 5:136132991-136133013 CGAGGGGAACTGGGGGCTGCAGG + Intronic
999193745 5:149767833-149767855 GGGTGGGGGGTGGCGGATGCAGG + Intronic
999252305 5:150190173-150190195 CGCTGCCGTCTGGCGGCTGCGGG - Exonic
999370450 5:151052118-151052140 GGGTGAGGAGTGGGGGCTGCAGG - Intronic
1002646529 5:180659221-180659243 AGGTGGGGACTGGGGGGTGGGGG - Intergenic
1004611992 6:17250800-17250822 CGATGGACACTGGCGACTGCTGG - Intergenic
1006153746 6:32002947-32002969 CCGTGGTGACTGGCGACAGCCGG - Intergenic
1006160054 6:32035684-32035706 CCGTGGTGACTGGCGACAGCCGG - Intergenic
1007417546 6:41700829-41700851 GGGTGGGAACTGGCGCCTCCTGG + Intronic
1007739544 6:44002394-44002416 CGGTGGCGGCCGGCGGCAGCAGG - Intronic
1007924844 6:45642655-45642677 CGGTGGAGAATGGCTGCTGGTGG - Intronic
1012625738 6:101401943-101401965 CGGAGGCGCCTGGCGGCTGCCGG - Intronic
1016383669 6:143511343-143511365 GGGTGGTGGCTGGAGGCTGCGGG + Intronic
1017457562 6:154615748-154615770 CTGTGGTGAGTGGCGGCTGCTGG + Intergenic
1017570119 6:155735237-155735259 CCTTGGGGACTGGCTTCTGCAGG + Intergenic
1017605688 6:156129879-156129901 CAGAGGGGACTGGTGGCTGAGGG - Intergenic
1017827383 6:158091945-158091967 GGGTGGGGAGTGGCTGCTGTGGG + Intronic
1017962165 6:159232524-159232546 GGACGGGGACTGGCGGCTGGGGG - Exonic
1018876338 6:167826200-167826222 CGGTCCGGACTGGCGGGTCCGGG - Intergenic
1019199964 6:170306389-170306411 CACTGAGGACTGGCGGCTCCCGG - Intronic
1019411752 7:909619-909641 TGGTGCCGACTGGGGGCTGCAGG - Intronic
1020106247 7:5423538-5423560 CGGAGGGGAGCGGCGGCCGCGGG - Exonic
1022383909 7:29884483-29884505 CGGTGGGGCCTGGAAGCTGGGGG - Exonic
1023737700 7:43249113-43249135 AGGTGGGGACGGGCGGCGCCCGG - Intronic
1023867334 7:44244435-44244457 CGGTGGGGTCTCTTGGCTGCAGG + Intronic
1024818898 7:53303987-53304009 CTGTGGGGACTTGCATCTGCAGG - Intergenic
1025582843 7:62741992-62742014 CAGTCGGGACTGTCAGCTGCAGG + Intergenic
1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG + Exonic
1027218282 7:76198196-76198218 GGGTTGGGGCTGGCGGCTGCAGG - Intergenic
1027654960 7:80919185-80919207 GGGTGGGGCCTCGCGGCTGGCGG - Exonic
1029113997 7:98228117-98228139 CTGTGGGGAGAGGTGGCTGCTGG + Intronic
1029280641 7:99433320-99433342 CGGTGCTGATTGGGGGCTGCGGG - Exonic
1029599214 7:101553926-101553948 CTGTGGGGACCTGCGGCTTCTGG + Intronic
1029844231 7:103396652-103396674 CGGTGGTTACTGGGGGCTGGGGG + Intronic
1033422596 7:141216975-141216997 AGGAGGGGACAGGCAGCTGCAGG + Intronic
1034901935 7:154913440-154913462 GGGTGGGGAGAGGCCGCTGCAGG - Intergenic
1034993819 7:155565812-155565834 AGGTGTGGACAGGGGGCTGCTGG - Intergenic
1035020809 7:155799102-155799124 CGGTAGGGGCTGGGGGCTGAGGG - Intergenic
1035166480 7:156993370-156993392 AGCTGGGCCCTGGCGGCTGCAGG + Intergenic
1035521167 8:275853-275875 CGATGAGGACTGGAAGCTGCAGG + Intergenic
1035538108 8:407413-407435 AGGTGGGGTCTGGGGGCGGCCGG + Intronic
1037359206 8:18054861-18054883 CGGTGTGGTCTGGAGCCTGCTGG + Intergenic
1038303816 8:26381571-26381593 TGGTAGGGATTGGCGGCTGCTGG - Intergenic
1038331743 8:26614400-26614422 GGGTGGGGACAGGCGGTAGCTGG + Intronic
1039549917 8:38435968-38435990 AGGTGGGGAATGGAGGCTGGAGG + Intronic
1040055939 8:43056679-43056701 CGCTGGGCCCGGGCGGCTGCCGG + Intronic
1042082701 8:65072173-65072195 CGGTGGGGGTTGGGGGGTGCAGG + Intergenic
1049090659 8:140511455-140511477 CGGTCGGGCCCGCCGGCTGCGGG + Exonic
1049218794 8:141419493-141419515 AGGTGGGGACTGGCGGGACCAGG + Intronic
1049229244 8:141473505-141473527 CGGGGGGGAGTGGGGGCAGCGGG + Intergenic
1049268771 8:141683288-141683310 GGCTGGGGACTGGGGGCTGGGGG + Intergenic
1049419547 8:142510758-142510780 CCGCGGGGCCTGGCGGCGGCGGG + Intronic
1049659035 8:143811550-143811572 TGGTGGGGACTGAAGGCTGAGGG - Intronic
1049684049 8:143932159-143932181 TGCTGGGGACCGGCTGCTGCGGG - Exonic
1049814519 8:144591913-144591935 CTGTGGGGAGTGGTGCCTGCAGG + Intronic
1049997323 9:1045509-1045531 GGGTGGGGAGTGGAGACTGCGGG - Intergenic
1051265540 9:15306196-15306218 CTGTGGGTGCTGGCTGCTGCTGG + Intronic
1055513507 9:77016634-77016656 CGTTGGGCACTTGCGGCTCCTGG - Intergenic
1058625421 9:106928748-106928770 CGAGGGGGACTGGCAGCTTCGGG - Exonic
1060180003 9:121527436-121527458 CAGTGGGGGCTGGGGGCTGGGGG + Intergenic
1060192071 9:121599652-121599674 CGGTGTCGCCGGGCGGCTGCAGG - Intronic
1060401882 9:123354238-123354260 AGGTGGAGTGTGGCGGCTGCAGG + Intergenic
1060721661 9:125983652-125983674 TGGTGGGGACTGGGGGCTCAGGG - Intergenic
1061205977 9:129163696-129163718 AGATGGGGCCTGGCAGCTGCTGG + Intergenic
1061401298 9:130369850-130369872 GGGTGAGGACCGGCAGCTGCTGG + Intronic
1061725580 9:132580460-132580482 GGGTGAGGACGGGCGGCTCCCGG - Intergenic
1061821217 9:133228114-133228136 CGGTAGAGTCTGGGGGCTGCAGG - Intergenic
1061834227 9:133318250-133318272 CGGTAGAGTCTGGGGGCTGCAGG + Intergenic
1061876387 9:133546236-133546258 TGGTGGGGAGTGGGGGCTGCAGG + Intronic
1061897649 9:133656845-133656867 GGGTGGGTAATGGCTGCTGCAGG - Intronic
1061949781 9:133929805-133929827 CGGTGGGGACAGGCCGCTGGGGG - Intronic
1062167145 9:135113547-135113569 CGCTGGAGACTGGCGGTGGCTGG + Intronic
1062480245 9:136747736-136747758 GGGTGGAGGCTGGAGGCTGCAGG - Intronic
1203572030 Un_KI270744v1:140704-140726 CGGCGGGAAATGGCGGCGGCGGG - Intergenic
1187849546 X:23578202-23578224 CAGTGTGGACTGGTGGCTGGTGG - Intergenic
1192260485 X:69503733-69503755 GGGTGGGGGGTGGAGGCTGCTGG + Intergenic
1194708169 X:97200700-97200722 CTGTGGGGAGGGGCAGCTGCAGG + Intronic
1198241943 X:134796293-134796315 TGCTGGGGACTGGCAGCTGGGGG + Intronic
1199595837 X:149505165-149505187 CGGCGGGGACAGGCTGCAGCAGG + Intronic
1200060317 X:153481035-153481057 AGGTGGGGCCTGGGGCCTGCTGG + Intronic
1200235634 X:154466559-154466581 CCGTGGGGACGGGTGGCTGAGGG + Intronic