ID: 1026817145

View in Genome Browser
Species Human (GRCh38)
Location 7:73521945-73521967
Sequence CGGTGGGGACTGGCGGCTGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 299}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026817141_1026817145 -8 Left 1026817141 7:73521930-73521952 CCATCGCGGCGGCGGCGGTGGGG 0: 1
1: 1
2: 6
3: 89
4: 488
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817134_1026817145 5 Left 1026817134 7:73521917-73521939 CCCAGGAGCGGCGCCATCGCGGC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817130_1026817145 25 Left 1026817130 7:73521897-73521919 CCAGCGGGAAGGGCTTGCGGCCC 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299
1026817135_1026817145 4 Left 1026817135 7:73521918-73521940 CCAGGAGCGGCGCCATCGCGGCG 0: 1
1: 0
2: 1
3: 7
4: 72
Right 1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG 0: 1
1: 0
2: 1
3: 25
4: 299

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026817145 Original CRISPR CGGTGGGGACTGGCGGCTGC TGG Exonic