ID: 1026817150

View in Genome Browser
Species Human (GRCh38)
Location 7:73521970-73521992
Sequence CTAGTGCTGCGCCGCGGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 141}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026817150_1026817163 11 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817163 7:73522004-73522026 CGGAGCGAGCGCCAGGCGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 131
1026817150_1026817165 13 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817165 7:73522006-73522028 GAGCGAGCGCCAGGCGCCCGGGG 0: 1
1: 0
2: 4
3: 11
4: 138
1026817150_1026817178 30 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817178 7:73522023-73522045 CCGGGGGTGGGGTGGGGGAAGGG 0: 1
1: 9
2: 70
3: 731
4: 7479
1026817150_1026817164 12 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817164 7:73522005-73522027 GGAGCGAGCGCCAGGCGCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 206
1026817150_1026817172 23 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817172 7:73522016-73522038 CAGGCGCCCGGGGGTGGGGTGGG 0: 1
1: 0
2: 3
3: 67
4: 677
1026817150_1026817156 -9 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817156 7:73521984-73522006 CAGCACTAGGCCCCGCGGCCCGG 0: 1
1: 0
2: 1
3: 14
4: 153
1026817150_1026817160 4 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817160 7:73521997-73522019 CGCGGCCCGGAGCGAGCGCCAGG 0: 1
1: 0
2: 1
3: 20
4: 213
1026817150_1026817167 17 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817167 7:73522010-73522032 GAGCGCCAGGCGCCCGGGGGTGG 0: 1
1: 0
2: 2
3: 14
4: 329
1026817150_1026817166 14 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817166 7:73522007-73522029 AGCGAGCGCCAGGCGCCCGGGGG 0: 1
1: 0
2: 0
3: 10
4: 119
1026817150_1026817174 25 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817174 7:73522018-73522040 GGCGCCCGGGGGTGGGGTGGGGG 0: 1
1: 1
2: 15
3: 187
4: 1449
1026817150_1026817171 22 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817171 7:73522015-73522037 CCAGGCGCCCGGGGGTGGGGTGG 0: 1
1: 0
2: 5
3: 95
4: 709
1026817150_1026817168 18 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817168 7:73522011-73522033 AGCGCCAGGCGCCCGGGGGTGGG 0: 1
1: 0
2: 1
3: 16
4: 203
1026817150_1026817173 24 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817173 7:73522017-73522039 AGGCGCCCGGGGGTGGGGTGGGG 0: 1
1: 0
2: 9
3: 106
4: 909
1026817150_1026817176 29 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817176 7:73522022-73522044 CCCGGGGGTGGGGTGGGGGAAGG 0: 1
1: 5
2: 66
3: 449
4: 3358
1026817150_1026817169 19 Left 1026817150 7:73521970-73521992 CCGGCCCCGCGGCGCAGCACTAG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 1026817169 7:73522012-73522034 GCGCCAGGCGCCCGGGGGTGGGG 0: 1
1: 0
2: 3
3: 25
4: 368

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026817150 Original CRISPR CTAGTGCTGCGCCGCGGGGC CGG (reversed) Exonic
900409923 1:2507867-2507889 CTGGTGCTGAGCTGCTGGGCAGG - Intergenic
900673243 1:3868796-3868818 CTAGTGCTGCCCTGCGTGGTCGG + Intronic
901601461 1:10426536-10426558 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
907431830 1:54416666-54416688 CTAGTGCTGTGGCGCTGAGCAGG + Intergenic
908195532 1:61742848-61742870 CGAGCCCTGCGCGGCGGGGCGGG - Intronic
910981166 1:92961302-92961324 CGAGTCCTGCGCGGCGCGGCAGG + Intronic
911664827 1:100540096-100540118 CCAGTGCTGGCCCGCGGCGCGGG - Exonic
917067674 1:171114331-171114353 CTTGTGCTGCCCAGCGGGACTGG - Exonic
920731358 1:208488614-208488636 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
923372657 1:233328339-233328361 CGAGGGCGGCGGCGCGGGGCTGG - Exonic
1064028750 10:11869823-11869845 CTTGGGCTGCGCCGGGTGGCTGG - Exonic
1068461629 10:57336999-57337021 CTAGTGCGGGGCCGCTGAGCGGG + Intergenic
1070954289 10:80454294-80454316 CAAGTTCCGCGGCGCGGGGCGGG - Exonic
1070973395 10:80586059-80586081 CAAGTGCAGTGCCGCTGGGCCGG - Intronic
1076555858 10:131321041-131321063 CTGCTGCTGCTCCGAGGGGCTGG + Intergenic
1076643898 10:131938075-131938097 TCAGTGCAGCGACGCGGGGCAGG + Intronic
1081758696 11:45562136-45562158 CTAGTGGGGCGGGGCGGGGCAGG + Intergenic
1085451492 11:76636752-76636774 CTAGTGCTAAGCCTGGGGGCAGG + Intergenic
1089256307 11:117196156-117196178 CCAGTGCTGGGCAGCGGTGCTGG - Exonic
1092272937 12:7037604-7037626 CAAGTGCAGCGCCGGTGGGCTGG - Intronic
1092350506 12:7752250-7752272 CAAGTGCAGCGCCGGTGGGCTGG + Intergenic
1092366567 12:7881466-7881488 CGAGTGCAGCGCCGGTGGGCCGG - Intronic
1092472974 12:8794907-8794929 CGAGTGCAGCGCCGGTGGGCTGG - Intergenic
1094327574 12:29256826-29256848 CCAGTGCAGCGCCGTTGGGCTGG - Intronic
1099523926 12:83696463-83696485 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1102571658 12:113830561-113830583 CTAGGGCTGCGGGGCGGGGGGGG + Intronic
1104859165 12:131915838-131915860 CTAGGGCTGGGCCGCCGGACCGG + Intronic
1104983171 12:132582906-132582928 CCGGGGCTGCGCCGCGCGGCAGG + Intronic
1105605144 13:21920842-21920864 CGAGCGCAGCGCCGCTGGGCCGG + Intergenic
1106643419 13:31609004-31609026 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1108099166 13:46936232-46936254 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1110940284 13:81340948-81340970 CAAGTGCAGCGCCGGTGGGCTGG + Intergenic
1110999834 13:82165127-82165149 CGAGCGCTGCGCCGGTGGGCCGG + Intergenic
1117297580 14:54393624-54393646 CGAGTGCAGCGCCGGTGGGCTGG - Intergenic
1117302523 14:54443235-54443257 CGAGTGCAGCGCCGGTGGGCTGG - Intergenic
1118610163 14:67533432-67533454 CTGGGGCTGCGCCGCGGCGGAGG + Intronic
1122750325 14:103928302-103928324 CTAGCGCGGCGGGGCGGGGCCGG + Intergenic
1123949119 15:25253370-25253392 CAAGTGCAGCGCCGGTGGGCTGG + Intergenic
1130657340 15:85800918-85800940 CTGGTGCTGCGCCCTGGGCCCGG + Intergenic
1130970388 15:88727614-88727636 CTAGTGGTGCCCAGCTGGGCTGG - Intergenic
1132804300 16:1768584-1768606 CTGGTGCTGAGCGGCGGGGAGGG + Exonic
1133188519 16:4116575-4116597 CTGGGGCTGCGGGGCGGGGCGGG + Intergenic
1135589676 16:23695912-23695934 GACGTGCTGGGCCGCGGGGCAGG - Exonic
1139446249 16:67000460-67000482 CCAGTCCTGGGCCCCGGGGCTGG + Intronic
1141465736 16:84204792-84204814 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1141694130 16:85611986-85612008 CCAGCGCTGCGCTGCGGTGCGGG - Intronic
1142120135 16:88383079-88383101 CGCGCGCTGCGCCTCGGGGCGGG - Intergenic
1142197656 16:88746151-88746173 CTAGGGCTGAGCTGCGGGGTAGG + Intronic
1143372282 17:6447768-6447790 ATAGTGCTTCACCCCGGGGCTGG + Intronic
1146637428 17:34516872-34516894 CTGGTGCTGAGCCCTGGGGCTGG - Intergenic
1149746794 17:59106665-59106687 CTACTTCTGCGCCTCGGGGCGGG - Exonic
1150624895 17:66835321-66835343 CCGGTGCTGGGCCGCGGCGCCGG + Intronic
1152396347 17:80035868-80035890 CCAGTGAGGCGCGGCGGGGCGGG + Intergenic
1153382497 18:4454978-4455000 GCCGGGCTGCGCCGCGGGGCTGG - Intronic
1155209333 18:23586965-23586987 CGAGTGCGGCGGGGCGGGGCGGG + Intergenic
1156362384 18:36394452-36394474 CTAGTGCTGCGGGGTGGGGATGG - Intronic
1157796610 18:50580719-50580741 CTAGTGCTGTTCCACGGAGCAGG - Intronic
1159040541 18:63319920-63319942 CTGGTCCTGCGCGGCGGCGCTGG + Exonic
1160788776 19:913252-913274 CTGGGGCTGCGCGGCGGGGCGGG + Intergenic
1161977062 19:7612783-7612805 CCAGGGCTGCGCCGGGTGGCCGG - Exonic
1163018939 19:14472631-14472653 CAAGGGCGGCCCCGCGGGGCTGG - Exonic
1163529723 19:17842353-17842375 CTGGGGCTGCTCCGCGTGGCTGG - Exonic
1164157301 19:22604409-22604431 ACAGTGCTGAGCAGCGGGGCTGG + Intergenic
1165828836 19:38720473-38720495 CCAGGGCTGCGCAGCAGGGCCGG + Intronic
1167732761 19:51270954-51270976 CTAGTGCTGGACCCCAGGGCTGG - Intergenic
925927251 2:8679180-8679202 CGCGTGATGCGCCGGGGGGCGGG - Exonic
931719299 2:65055895-65055917 CAGGTGCTGCGAGGCGGGGCGGG - Intergenic
936954826 2:118013596-118013618 CTAGCCCTGCGGCGCGGGGTGGG + Intronic
938401037 2:130991629-130991651 CTAGTGCAGCGCGGGTGGGCTGG - Intronic
938703276 2:133898233-133898255 CTGGTGCTGCGCCCTGGGCCTGG + Intergenic
938904850 2:135827810-135827832 CTGGTGCTCCGCCTGGGGGCTGG + Intronic
940666696 2:156618234-156618256 CGAGAGCTGCGCCGGTGGGCTGG + Intergenic
941819211 2:169827822-169827844 CGAGTTCTGCGCGGCGGTGCGGG + Exonic
943680330 2:190761131-190761153 CGAGTGCAGCGCCGGTGGGCCGG + Intergenic
944228444 2:197370754-197370776 CGAGTGCAGCGCCGGTGGGCCGG - Intergenic
947399094 2:229714518-229714540 CTAGGGCTGCTCCGCCGGGCCGG + Exonic
947724109 2:232386950-232386972 CTAGTGCTGGGCAGCGCCGCCGG + Intergenic
948487413 2:238289537-238289559 CTAGTGATGCGCTTGGGGGCAGG - Intronic
948560404 2:238847909-238847931 AAAGTGCCGCGCCGGGGGGCGGG + Intergenic
948813934 2:240500118-240500140 CTGGTGCTGTGCCGCAGGACCGG - Exonic
1171249436 20:23637346-23637368 CTCGAGCTGCGCCGCAGCGCGGG - Intronic
1172245638 20:33443562-33443584 CTGGAGCTGCGCGCCGGGGCGGG - Exonic
1173005949 20:39139779-39139801 ATAGTGCTGCGAGGCAGGGCTGG - Intergenic
1173165182 20:40682890-40682912 CTAGTGCTGCGCGGTGGCTCGGG + Intergenic
1183737044 22:39649927-39649949 CCAGTGCAGCGCAGCCGGGCCGG + Intronic
1185229114 22:49670378-49670400 CGAGCGCAGCGCCGGGGGGCCGG + Intergenic
949876836 3:8631773-8631795 CTGGTGCTGCCACACGGGGCCGG - Intronic
950600367 3:14029671-14029693 CGAGTGCAGCGCCGGTGGGCTGG + Intronic
953124502 3:40078103-40078125 CTAGCGCAGCGCCGGTGGGCTGG + Intronic
960149792 3:114238466-114238488 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
960560031 3:119073579-119073601 CTAGTGCAGTGCCGGTGGGCCGG + Intronic
961464576 3:127073394-127073416 CTAGGGCTGGGCCTAGGGGCTGG - Intergenic
963651817 3:147989557-147989579 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
966846614 3:184135436-184135458 CAAGCGCAGCGGCGCGGGGCCGG + Exonic
968151138 3:196337578-196337600 CTAGTGCTGCTCCGCGGGTAAGG + Intronic
973039929 4:45457291-45457313 CGAGTGCAGCGCCGGTGGGCCGG + Intergenic
973817594 4:54632721-54632743 CGAGTGCAGCGCCGGTGGGCCGG - Intergenic
975898445 4:79122117-79122139 CAAGTGCAGCGCCGGTGGGCCGG - Intergenic
976690595 4:87863844-87863866 CCAGCGCAGCGCCGGGGGGCCGG + Intergenic
979308333 4:119173970-119173992 CAAGTGCAGCGCCGGTGGGCTGG - Intronic
982921283 4:161277435-161277457 CGAGTGCAGCGCCGGTGGGCCGG - Intergenic
984639354 4:182144802-182144824 CTAGTGCCGGGCCGCGGCGCCGG + Intronic
985129152 4:186724061-186724083 CTAGCGCGGCTCCGAGGGGCAGG + Intronic
986330780 5:6714507-6714529 CTGGTGCTGCGACGGGGAGCCGG - Intergenic
986912373 5:12574120-12574142 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
987476683 5:18399848-18399870 CAAGTGCAGCGCCGGTGGGCTGG + Intergenic
987532771 5:19142946-19142968 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
990382810 5:55233009-55233031 CTTGTGCTTCGACTCGGGGCGGG + Intronic
993770301 5:91917461-91917483 CGAGTGCAGCGCCGCTGGGCCGG - Intergenic
994509831 5:100689044-100689066 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
995181507 5:109234726-109234748 CTAGTGCTGCCCCCTGGGGCTGG - Intergenic
995679855 5:114704464-114704486 CAAGTGCAGCGCCGGTGGGCCGG + Intergenic
995725471 5:115177616-115177638 CTGGGGCTGCGGGGCGGGGCAGG + Intronic
1000891807 5:166810371-166810393 CGAGTGCAGCGCCGGTGGGCCGG + Intergenic
1004200279 6:13541726-13541748 CGAGTGCAGCGCCGCTGGGCCGG - Intergenic
1006005783 6:31000650-31000672 CGAGTGCAGCGCCGGCGGGCTGG - Intergenic
1006512120 6:34527167-34527189 TTGCCGCTGCGCCGCGGGGCGGG + Intronic
1015431310 6:133132793-133132815 CGAGTGTTGGGCCCCGGGGCTGG - Intergenic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1015776799 6:136822763-136822785 GTAGTGCTGCGCGGTGGCGCAGG - Exonic
1019647866 7:2140611-2140633 CTCGTGCTGGGATGCGGGGCCGG - Intronic
1020244898 7:6422418-6422440 CGAGTGCTGTGCTGCTGGGCTGG + Intronic
1022471151 7:30682522-30682544 CAATGGCTGCGCCGGGGGGCGGG + Intronic
1025916823 7:65873043-65873065 GTGGCGCTGCGCCGCGCGGCCGG - Intergenic
1026806897 7:73434489-73434511 CTTGTGGGGCTCCGCGGGGCCGG - Exonic
1026817150 7:73521970-73521992 CTAGTGCTGCGCCGCGGGGCCGG - Exonic
1026837402 7:73647907-73647929 CGTGCGCTGCGCCGCGGGCCCGG + Intergenic
1027674483 7:81141923-81141945 CGAGTGCAGCGCCGGTGGGCCGG - Intergenic
1029677461 7:102080169-102080191 CTAGTGCTGTGTCGAGGGACCGG - Intronic
1034200136 7:149279084-149279106 CTAGTGTTCCTCTGCGGGGCTGG + Intronic
1034446162 7:151115272-151115294 CCAGTGCTGCGCGGCGGGCGCGG + Intronic
1037819947 8:22130722-22130744 TCCGTGCTGCGCCGCGGGGAGGG + Exonic
1038089275 8:24235612-24235634 CTGGTGCTGCGCCCCGGACCTGG + Intergenic
1038639414 8:29311650-29311672 CGAGTGCAGCGCCGGTGGGCTGG - Intergenic
1040474305 8:47763408-47763430 CTCTTTCTGCGCCGCCGGGCTGG + Intergenic
1045489396 8:102656886-102656908 CGTGTGCTGCGCCTGGGGGCTGG + Intergenic
1058286573 9:103187087-103187109 CGAGTGCTGCACCGGTGGGCCGG - Intergenic
1059810630 9:117852210-117852232 CCAGTGCAGCGCCGGTGGGCTGG - Intergenic
1060151956 9:121294509-121294531 CTAGTGCTGGGACCCAGGGCTGG - Intronic
1061483836 9:130910306-130910328 CGAGTGCAGCGCCGGTGGGCTGG - Intronic
1061926896 9:133810337-133810359 CTCGTGCTGCCCAGCTGGGCAGG + Intronic
1062405178 9:136392813-136392835 CGAGGGCTGCGGGGCGGGGCAGG + Intronic
1062497226 9:136837587-136837609 ATGATGCTGCGCCGTGGGGCGGG - Exonic
1062637310 9:137498407-137498429 GCAGTGCTGTGCCGTGGGGCAGG - Intronic
1187226133 X:17376401-17376423 CCGGAGCGGCGCCGCGGGGCTGG - Intronic
1196860854 X:120025962-120025984 CGAGTGCAGCGCCGGCGGGCCGG + Intergenic
1197000282 X:121431705-121431727 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1197344820 X:125319239-125319261 CGAGTGCAGCGCCGGTGGGCTGG + Intergenic
1198750561 X:139933055-139933077 TTGCTGCTGCGCAGCGGGGCGGG + Intronic
1201715812 Y:17043296-17043318 CTAGCGCAGCGCCGGTGGGCTGG - Intergenic