ID: 1026817315

View in Genome Browser
Species Human (GRCh38)
Location 7:73522644-73522666
Sequence TGTCCGTGTGGTGCGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026817309_1026817315 -5 Left 1026817309 7:73522626-73522648 CCGACATCCGGGCACCACTGTCC No data
Right 1026817315 7:73522644-73522666 TGTCCGTGTGGTGCGCCGGAGGG No data
1026817306_1026817315 7 Left 1026817306 7:73522614-73522636 CCGACGGCGACACCGACATCCGG No data
Right 1026817315 7:73522644-73522666 TGTCCGTGTGGTGCGCCGGAGGG No data
1026817305_1026817315 17 Left 1026817305 7:73522604-73522626 CCATCTGTCACCGACGGCGACAC No data
Right 1026817315 7:73522644-73522666 TGTCCGTGTGGTGCGCCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026817315 Original CRISPR TGTCCGTGTGGTGCGCCGGA GGG Intergenic
No off target data available for this crispr