ID: 1026817325

View in Genome Browser
Species Human (GRCh38)
Location 7:73522668-73522690
Sequence GAGGGTGAGCGCGCGGCCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026817311_1026817325 12 Left 1026817311 7:73522633-73522655 CCGGGCACCACTGTCCGTGTGGT No data
Right 1026817325 7:73522668-73522690 GAGGGTGAGCGCGCGGCCAGGGG No data
1026817318_1026817325 -2 Left 1026817318 7:73522647-73522669 CCGTGTGGTGCGCCGGAGGGGGA No data
Right 1026817325 7:73522668-73522690 GAGGGTGAGCGCGCGGCCAGGGG No data
1026817309_1026817325 19 Left 1026817309 7:73522626-73522648 CCGACATCCGGGCACCACTGTCC No data
Right 1026817325 7:73522668-73522690 GAGGGTGAGCGCGCGGCCAGGGG No data
1026817312_1026817325 5 Left 1026817312 7:73522640-73522662 CCACTGTCCGTGTGGTGCGCCGG No data
Right 1026817325 7:73522668-73522690 GAGGGTGAGCGCGCGGCCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026817325 Original CRISPR GAGGGTGAGCGCGCGGCCAG GGG Intergenic