ID: 1026819412

View in Genome Browser
Species Human (GRCh38)
Location 7:73536864-73536886
Sequence CCCGGACTTTCCCCTAGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026819412_1026819417 14 Left 1026819412 7:73536864-73536886 CCAGTCCTAGGGGAAAGTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026819412 Original CRISPR CCCGGACTTTCCCCTAGGAC TGG (reversed) Exonic