ID: 1026819412

View in Genome Browser
Species Human (GRCh38)
Location 7:73536864-73536886
Sequence CCCGGACTTTCCCCTAGGAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 78}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026819412_1026819417 14 Left 1026819412 7:73536864-73536886 CCAGTCCTAGGGGAAAGTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026819412 Original CRISPR CCCGGACTTTCCCCTAGGAC TGG (reversed) Exonic
903345155 1:22679755-22679777 CCCGGGCATTCCCCTAGATCTGG + Intergenic
904260788 1:29286562-29286584 CCCTGACTTTCCCCCAGCAGGGG + Intronic
907102956 1:51853834-51853856 CCCTGACTGTCCCTAAGGACTGG + Intronic
908195643 1:61743227-61743249 CCAGGAATTTCCCCTAAGGCTGG - Intronic
908450678 1:64251846-64251868 CCCATACATTCCCCTAGGAAGGG + Intronic
910508433 1:87977017-87977039 CCCTGACCTTCCCGTTGGACTGG + Intergenic
919511234 1:198467309-198467331 AAAGGACTTTCCCCTAGGATAGG - Intergenic
920689856 1:208137658-208137680 CCCAAATTTTCCCCTGGGACTGG + Intronic
922165564 1:223112998-223113020 CCTGGACCTTCTCCTAGGAGTGG - Exonic
1063105824 10:2991215-2991237 CCCTGGATTTCCCCTAGGAGCGG - Intergenic
1067477730 10:46577870-46577892 CACTGACTGCCCCCTAGGACAGG + Intergenic
1067617007 10:47763914-47763936 CACTGACTGGCCCCTAGGACAGG - Intergenic
1070776898 10:79115009-79115031 CCAGGCCTTTCCCCTGGGAGTGG - Intronic
1080241734 11:30134577-30134599 CCAGCACTTTCCCCTTGCACTGG + Intergenic
1091278728 11:134370108-134370130 CCCTGGCTTTCCCCCAGGCCTGG + Intronic
1094425262 12:30310383-30310405 TCCAGACATTCCCCTAGGAAGGG + Intergenic
1102929643 12:116852370-116852392 CCAGGACTTTCCCCTTGGCTTGG + Intronic
1114163995 14:20200016-20200038 CTTGAACTTTCCCCTAGGCCTGG + Intergenic
1115753903 14:36515309-36515331 CCAGCACTTTCCTCTAGGCCTGG - Intergenic
1119294674 14:73523186-73523208 CCAGGCCTTTCCTCTAGGCCAGG - Exonic
1122337919 14:101005946-101005968 CCTGGACTGACCCCTGGGACAGG + Intergenic
1130886213 15:88094650-88094672 CCTGGGCTTTCTCCTAGGGCTGG + Intronic
1131871323 15:96767882-96767904 TCCGGAATTTCCCCTGGGCCAGG - Intergenic
1136083363 16:27867602-27867624 CTCAGCCTTTCCCCTACGACAGG + Intronic
1140113524 16:72022932-72022954 CCACAACATTCCCCTAGGACAGG - Intronic
1144683041 17:17207560-17207582 CCCGCCCTTTCTCCTAGGAGTGG - Intronic
1147607867 17:41784664-41784686 CACTGACTTCCCCCTAGCACAGG + Intronic
1157009735 18:43632453-43632475 CCCAGACTTTCTCCTAATACAGG + Intergenic
1158721285 18:59927371-59927393 CCTGGACTTTCCCTTTGGGCAGG - Intergenic
1165024140 19:32947328-32947350 CCAGGTCTTTCCCCAAGCACTGG + Intronic
1167620124 19:50555970-50555992 CCGGGTCTCTCCCATAGGACCGG - Intronic
1168559659 19:57372404-57372426 CTGTGTCTTTCCCCTAGGACTGG + Intronic
934861044 2:97763753-97763775 CCCGCACCTTTCCCCAGGACAGG - Intronic
935191249 2:100780452-100780474 CCCCATCTTTCCCCTAGGCCAGG + Intergenic
936519750 2:113204272-113204294 CCCAGTCTTTTCCCTAGGAGAGG - Intronic
937921991 2:127137402-127137424 CCGGGCCTGTCCCCTGGGACTGG - Intergenic
938212648 2:129481589-129481611 CCCAGACCTTCCCCAAGGAAGGG + Intergenic
940453875 2:153872441-153872463 CCCTGCCTTTGCCCTGGGACCGG - Intronic
944198214 2:197077464-197077486 CCTGGACTTTCCCCTAGGAGTGG - Intronic
948669722 2:239560004-239560026 CCAGGACATTCCCCCAGGACGGG + Intergenic
948793641 2:240391532-240391554 CCAGGACATTCCTCTAGGTCAGG - Intergenic
1173400200 20:42719434-42719456 TCAGGACTTTCCCTCAGGACTGG - Intronic
1173918432 20:46726365-46726387 CCCAAACTTCCCCCTAGGAGGGG - Intronic
1176106494 20:63392032-63392054 CCTGGACCTTCCCCTCAGACGGG - Intergenic
1176428001 21:6560539-6560561 CACGGACTGTCCCCGAGGCCTGG - Intergenic
1178553282 21:33560783-33560805 CCCAGACTTTTGCCAAGGACTGG + Intronic
1179703492 21:43168856-43168878 CACGGACTGTCCCCGAGGCCTGG - Intergenic
1180901717 22:19377823-19377845 CCTGAACTTTCCCCAGGGACAGG + Intronic
1181956422 22:26590322-26590344 CGCTGGCTTACCCCTAGGACGGG + Intronic
1182422592 22:30255897-30255919 CCTGGACTCTCCCCTAGCCCTGG - Intergenic
1184717042 22:46288299-46288321 CCCGGCCTCTCACCTGGGACAGG + Intronic
953791860 3:45953738-45953760 CCTGCACTTTGCCCTAGCACTGG - Intronic
954303743 3:49714737-49714759 CAAGGACTTTCCCCTAGGCCTGG + Intronic
954671677 3:52294390-52294412 GCAGGACTTTCCCCTGGGAAGGG + Intergenic
954745186 3:52783812-52783834 CCCGGACATCCCCCTGGGTCAGG - Intronic
955473336 3:59310087-59310109 CAGGCACTTTCCCCAAGGACAGG - Intergenic
961570955 3:127798493-127798515 CCAGGACTTCCTCCTTGGACAGG + Intronic
969320550 4:6409853-6409875 CCCAGACTTTCCCCTCTGCCTGG + Intronic
974278513 4:59759330-59759352 CCCTGACTTTACCCTAGGATAGG + Intergenic
1001288556 5:170440525-170440547 CTCTGACTCTCCCCTAGGAGGGG - Intronic
1001315562 5:170638922-170638944 ACCGGCCTCTCCCCTAGGCCTGG - Intronic
1003058099 6:2841288-2841310 CCCTGATTTCCCCCGAGGACAGG + Intronic
1005668449 6:28080959-28080981 CCCGGACTCACCTCTCGGACAGG - Exonic
1012277819 6:97295084-97295106 CCCAGCCTTTCCCCAAGGCCAGG - Intergenic
1012572199 6:100742924-100742946 CCTGGACATTCCCCTAGGTAGGG - Intronic
1013048060 6:106507458-106507480 CCCTGACTTTCCCACAGGCCTGG - Intergenic
1016362871 6:143286900-143286922 CCTGGACTTTCCCCACTGACTGG + Intronic
1024002373 7:45199183-45199205 CCTAGACTTTCCCTTAGGATGGG + Intergenic
1026819412 7:73536864-73536886 CCCGGACTTTCCCCTAGGACTGG - Exonic
1029207457 7:98878314-98878336 CCCGGGCATTCCCCGAGGCCTGG + Intronic
1034071560 7:148190836-148190858 CTCTGTCTTTCCCCTAGGGCTGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1037734702 8:21556659-21556681 CCTGGCCTTTCCTCTAGGCCTGG - Intergenic
1041117506 8:54554448-54554470 CCGGGGCTTTCCCATAGGGCCGG - Intergenic
1048239934 8:132731527-132731549 CCCCGACTTCACCATAGGACAGG + Intronic
1049011809 8:139892288-139892310 CCCTGACCTTCTCCTAGGAGGGG - Intronic
1060846422 9:126841119-126841141 CCCAGACTGTGCTCTAGGACTGG - Intergenic
1060846519 9:126841953-126841975 CCCAGACTGTGCTCTAGGACTGG + Intergenic
1060852640 9:126890091-126890113 CCCCGACCTTCCCCCAGAACGGG + Intergenic
1061504619 9:131024897-131024919 CCCTGACATCCCCCCAGGACAGG - Intronic
1186706476 X:12145403-12145425 ACCGGTCTTTACCCTAGTACAGG + Intronic
1189323903 X:40101673-40101695 CCTGGCCTTTCCCCTAGGCCAGG - Intronic
1191087856 X:56588216-56588238 ACTGGACTTTCCCCTGGCACTGG - Intergenic
1199183789 X:144891157-144891179 CTCTGTCTTTCCCCAAGGACAGG + Intergenic